Mutagenetix > Incidental Mutations

Incidental Mutation 'R6917:Ice1'

539412

Institutional Source

Beutler Lab

Gene Symbol

Ice1

Ensembl Gene

ENSMUSG00000034525

Gene Name

interactor of little elongation complex ELL subunit 1

Synonyms

BC018507

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.937) question?

Stock #

R6917 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

70551707-70637634 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 70594894 bp

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Asparagine at position 2116 (Y2116N)

Ref Sequence

ENSEMBL: ENSMUSP00000036482 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000043493] [ENSMUST00000220637]

Predicted Effect

probably damaging
Transcript: ENSMUST00000043493
AA Change: Y2116N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000036482
Gene: ENSMUSG00000034525
AA Change: Y2116N

Domain	Start	End	E-Value	Type
coiled coil region	22	185	N/A	INTRINSIC
low complexity region	276	292	N/A	INTRINSIC
low complexity region	338	351	N/A	INTRINSIC
low complexity region	372	378	N/A	INTRINSIC
low complexity region	469	481	N/A	INTRINSIC
low complexity region	606	619	N/A	INTRINSIC
low complexity region	769	780	N/A	INTRINSIC
low complexity region	946	958	N/A	INTRINSIC
low complexity region	1061	1073	N/A	INTRINSIC
low complexity region	1329	1352	N/A	INTRINSIC
low complexity region	1595	1604	N/A	INTRINSIC
low complexity region	1656	1671	N/A	INTRINSIC
SCOP:d1gw5a_	2026	2223	5e-6	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000220637

Predicted Effect

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.6%
20x: 95.6%

Validation Efficiency

96% (45/47)

Allele List at MGI

Other mutations in this stock

Total: 45 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abi3bp	A	G	16: 56,617,321		probably null	Het
Adcy2	A	T	13: 68,620,757	M1084K	possibly damaging	Het
Ak1	A	G	2: 32,631,152	Y95C	possibly damaging	Het
Akap6	A	G	12: 53,069,168	E1018G	probably null	Het
Ccdc175	A	G	12: 72,184,905	S27P	probably damaging	Het
Ddx31	C	T	2: 28,892,409	T588I	probably damaging	Het
Dmxl1	T	C	18: 49,864,148	W504R	probably damaging	Het
Echs1	T	G	7: 140,110,011	M239L	probably benign	Het
Eno1b	A	G	18: 48,047,589	D278G	probably benign	Het
Eno3	A	G	11: 70,661,436	T305A	probably benign	Het
Gm5591	T	A	7: 38,522,190	S152C	probably damaging	Het
Gngt1	A	G	6: 3,996,680	D42G	probably benign	Het
Gpatch2l	G	A	12: 86,244,184	R47H	probably damaging	Het
H2-Aa	T	C	17: 34,283,707	T79A	probably damaging	Het
Kdm6b	A	G	11: 69,406,593	M311T	probably benign	Het
L1td1	T	C	4: 98,734,031	F277L	probably benign	Het
Lamp1	T	C	8: 13,172,563	I249T	probably damaging	Het
Ldb3	G	A	14: 34,555,364	A351V	probably null	Het
Lmo7	A	G	14: 101,918,010	E996G	probably damaging	Het
Lsr	T	C	7: 30,958,296	D413G	possibly damaging	Het
Magel2	CCCTCCTCCTCCTCCTCCTCCT	CCCTCCTCCTCCTCCTCCT	7: 62,377,844		probably benign	Het
Myo7a	T	C	7: 98,095,763	E290G	possibly damaging	Het
Nos2	C	T	11: 78,951,227	T735M	possibly damaging	Het
Olfr1335	A	T	4: 118,809,129	L245H	probably damaging	Het
Olfr745	A	G	14: 50,643,223	K314R	possibly damaging	Het
Olfr957	T	A	9: 39,511,199	I174L	probably damaging	Het
Pik3c2g	T	C	6: 139,896,173	L768P	probably benign	Het
Plod2	T	A	9: 92,593,770	V302D	possibly damaging	Het
Ptgdr	A	T	14: 44,858,610	V215E	possibly damaging	Het
Rad51d	C	T	11: 82,879,333	R199Q	probably damaging	Het
Rsrc1	C	T	3: 66,994,649	P44L	unknown	Het
Rtel1	ATT	ATTTT	2: 181,338,277		probably null	Het
Sgip1	A	G	4: 102,968,191	R772G	probably damaging	Het
Slc19a2	C	A	1: 164,261,009	T141N	probably damaging	Het
Sp4	G	T	12: 118,299,173	N379K	probably damaging	Het
Thrap3	A	G	4: 126,180,492		probably benign	Het
Thumpd2	T	G	17: 81,044,114	I293L	probably benign	Het
Tjp1	A	G	7: 65,299,688	S1649P	probably damaging	Het
Tssk4	A	G	14: 55,652,407	S326G	probably benign	Het
Txndc9	A	C	1: 37,995,806	S6A	probably benign	Het
Uhrf1	T	C	17: 56,309,574	Y131H	probably damaging	Het
Vnn3	A	G	10: 23,865,934	D379G	possibly damaging	Het
Vsig2	T	A	9: 37,541,449	S105T	probably benign	Het
Zfp445	A	T	9: 122,862,294		probably null	Het
Zfp654	A	T	16: 64,786,471	M456K	probably damaging	Het

Other mutations in Ice1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00904:Ice1	APN	13	70602289	missense	probably damaging	1.00
IGL01155:Ice1	APN	13	70604082	missense	possibly damaging	0.93
IGL01298:Ice1	APN	13	70604904	missense	possibly damaging	0.93
IGL01797:Ice1	APN	13	70623946	missense	probably damaging	1.00
IGL02423:Ice1	APN	13	70592599	missense	probably damaging	1.00
IGL02583:Ice1	APN	13	70605735	missense	possibly damaging	0.80
IGL02794:Ice1	APN	13	70609159	missense	possibly damaging	0.95
IGL02882:Ice1	APN	13	70624474	splice site	probably benign
IGL02929:Ice1	APN	13	70596203	missense	probably damaging	1.00
IGL03343:Ice1	APN	13	70602929	missense	probably damaging	1.00
IGL03384:Ice1	APN	13	70603249	missense	probably benign	0.00
PIT4651001:Ice1	UTSW	13	70623921	critical splice donor site	probably null
R0078:Ice1	UTSW	13	70603348	missense	probably damaging	0.98
R0081:Ice1	UTSW	13	70619044	nonsense	probably null
R0281:Ice1	UTSW	13	70604047	missense	possibly damaging	0.64
R0557:Ice1	UTSW	13	70601191	missense	probably benign	0.08
R0973:Ice1	UTSW	13	70602427	missense	probably benign	0.04
R0973:Ice1	UTSW	13	70602427	missense	probably benign	0.04
R0974:Ice1	UTSW	13	70602427	missense	probably benign	0.04
R1033:Ice1	UTSW	13	70606594	missense	probably damaging	0.96
R1371:Ice1	UTSW	13	70596221	missense	probably damaging	1.00
R1525:Ice1	UTSW	13	70605410	missense	probably benign	0.01
R1539:Ice1	UTSW	13	70605904	missense	probably damaging	1.00
R1596:Ice1	UTSW	13	70604895	missense	possibly damaging	0.94
R1603:Ice1	UTSW	13	70603353	missense	probably benign	0.01
R1680:Ice1	UTSW	13	70605448	missense	probably benign	0.00
R1737:Ice1	UTSW	13	70606325	missense	probably damaging	0.99
R1766:Ice1	UTSW	13	70604442	missense	possibly damaging	0.78
R1774:Ice1	UTSW	13	70604553	missense	probably damaging	1.00
R1834:Ice1	UTSW	13	70615338	missense	probably damaging	0.99
R1840:Ice1	UTSW	13	70606218	missense	probably benign	0.00
R1898:Ice1	UTSW	13	70602307	missense	possibly damaging	0.83
R1930:Ice1	UTSW	13	70605083	missense	probably benign	0.18
R2000:Ice1	UTSW	13	70602427	missense	possibly damaging	0.58
R2106:Ice1	UTSW	13	70605622	missense	probably benign	0.00
R2293:Ice1	UTSW	13	70614957	missense	probably damaging	1.00
R2377:Ice1	UTSW	13	70602780	missense	probably damaging	1.00
R2909:Ice1	UTSW	13	70596173	missense	probably damaging	1.00
R2965:Ice1	UTSW	13	70602578	missense	probably benign	0.31
R3730:Ice1	UTSW	13	70603240	missense	probably damaging	1.00
R3886:Ice1	UTSW	13	70605370	missense	probably benign	0.00
R3914:Ice1	UTSW	13	70606084	missense	probably benign	0.30
R4051:Ice1	UTSW	13	70603527	missense	probably damaging	1.00
R4321:Ice1	UTSW	13	70603110	missense	possibly damaging	0.83
R4499:Ice1	UTSW	13	70609027	missense	possibly damaging	0.87
R4729:Ice1	UTSW	13	70606384	missense	probably damaging	1.00
R5078:Ice1	UTSW	13	70604850	missense	probably benign
R5431:Ice1	UTSW	13	70592650	missense	probably damaging	1.00
R5722:Ice1	UTSW	13	70615100	missense	possibly damaging	0.95
R5881:Ice1	UTSW	13	70606501	missense	probably benign	0.04
R5914:Ice1	UTSW	13	70606377	missense	possibly damaging	0.93
R6171:Ice1	UTSW	13	70606731	missense	probably benign
R6253:Ice1	UTSW	13	70603164	missense	probably damaging	1.00
R6274:Ice1	UTSW	13	70594839	missense	probably damaging	0.97
R6518:Ice1	UTSW	13	70606309	missense	possibly damaging	0.89
R6665:Ice1	UTSW	13	70603473	missense	possibly damaging	0.85
R6714:Ice1	UTSW	13	70615263	splice site	probably null
R6853:Ice1	UTSW	13	70603302	missense	possibly damaging	0.92
R7032:Ice1	UTSW	13	70596164	missense	probably damaging	0.99
R7176:Ice1	UTSW	13	70624406	critical splice donor site	probably null
R7352:Ice1	UTSW	13	70606102	nonsense	probably null
R7445:Ice1	UTSW	13	70596167	missense
R7646:Ice1	UTSW	13	70589797	missense	possibly damaging	0.93
R7647:Ice1	UTSW	13	70589797	missense	possibly damaging	0.93
R7648:Ice1	UTSW	13	70589797	missense	possibly damaging	0.93
R7650:Ice1	UTSW	13	70589797	missense	possibly damaging	0.93
R7650:Ice1	UTSW	13	70605483	missense	probably damaging	1.00
R7812:Ice1	UTSW	13	70603005	missense	possibly damaging	0.63
R8061:Ice1	UTSW	13	70603732	missense	probably damaging	1.00
R8129:Ice1	UTSW	13	70606201	missense	probably benign	0.02
R8283:Ice1	UTSW	13	70604430	missense	probably damaging	0.97
R8303:Ice1	UTSW	13	70606407	missense	probably benign	0.04
R8444:Ice1	UTSW	13	70604376	missense	probably damaging	1.00
R8474:Ice1	UTSW	13	70604447	missense	probably benign	0.42
R8751:Ice1	UTSW	13	70602891	missense	probably damaging	1.00
X0026:Ice1	UTSW	13	70592602	missense	probably damaging	1.00
Z1176:Ice1	UTSW	13	70605201	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CTGTGTATGTGTCAACACCAC -3'
(R):5'- TGCCAGGATCCTTTCAGTGG -3'

Sequencing Primer
(F):5'- GTGTATGTGTCAACACCACACTTAG -3'
(R):5'- GGAAGTACTATTCTTTCACCATGTC -3'

Posted On

2018-11-06