Incidental Mutation 'R6917:Ice1'
ID 539412
Institutional Source Beutler Lab
Gene Symbol Ice1
Ensembl Gene ENSMUSG00000034525
Gene Name interactor of little elongation complex ELL subunit 1
Synonyms BC018507
MMRRC Submission 045038-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.946) question?
Stock # R6917 (G1)
Quality Score 225.009
Status Validated
Chromosome 13
Chromosomal Location 70551707-70637634 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 70594894 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Asparagine at position 2116 (Y2116N)
Ref Sequence ENSEMBL: ENSMUSP00000036482 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043493] [ENSMUST00000220637]
AlphaFold E9Q286
Predicted Effect probably damaging
Transcript: ENSMUST00000043493
AA Change: Y2116N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000036482
Gene: ENSMUSG00000034525
AA Change: Y2116N

DomainStartEndE-ValueType
coiled coil region 22 185 N/A INTRINSIC
low complexity region 276 292 N/A INTRINSIC
low complexity region 338 351 N/A INTRINSIC
low complexity region 372 378 N/A INTRINSIC
low complexity region 469 481 N/A INTRINSIC
low complexity region 606 619 N/A INTRINSIC
low complexity region 769 780 N/A INTRINSIC
low complexity region 946 958 N/A INTRINSIC
low complexity region 1061 1073 N/A INTRINSIC
low complexity region 1329 1352 N/A INTRINSIC
low complexity region 1595 1604 N/A INTRINSIC
low complexity region 1656 1671 N/A INTRINSIC
SCOP:d1gw5a_ 2026 2223 5e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000220637
Predicted Effect
Predicted Effect
Meta Mutation Damage Score 0.0889 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 95.6%
Validation Efficiency 96% (45/47)
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abi3bp A G 16: 56,617,321 probably null Het
Adcy2 A T 13: 68,620,757 M1084K possibly damaging Het
Ak1 A G 2: 32,631,152 Y95C possibly damaging Het
Akap6 A G 12: 53,069,168 E1018G probably null Het
Ccdc175 A G 12: 72,184,905 S27P probably damaging Het
Ddx31 C T 2: 28,892,409 T588I probably damaging Het
Dmxl1 T C 18: 49,864,148 W504R probably damaging Het
Echs1 T G 7: 140,110,011 M239L probably benign Het
Eno1b A G 18: 48,047,589 D278G probably benign Het
Eno3 A G 11: 70,661,436 T305A probably benign Het
Gm5591 T A 7: 38,522,190 S152C probably damaging Het
Gngt1 A G 6: 3,996,680 D42G probably benign Het
Gpatch2l G A 12: 86,244,184 R47H probably damaging Het
H2-Aa T C 17: 34,283,707 T79A probably damaging Het
Kdm6b A G 11: 69,406,593 M311T probably benign Het
L1td1 T C 4: 98,734,031 F277L probably benign Het
Lamp1 T C 8: 13,172,563 I249T probably damaging Het
Ldb3 G A 14: 34,555,364 A351V probably null Het
Lmo7 A G 14: 101,918,010 E996G probably damaging Het
Lsr T C 7: 30,958,296 D413G possibly damaging Het
Magel2 CCCTCCTCCTCCTCCTCCTCCT CCCTCCTCCTCCTCCTCCT 7: 62,377,844 probably benign Het
Myo7a T C 7: 98,095,763 E290G possibly damaging Het
Nos2 C T 11: 78,951,227 T735M possibly damaging Het
Olfr1335 A T 4: 118,809,129 L245H probably damaging Het
Olfr745 A G 14: 50,643,223 K314R possibly damaging Het
Olfr957 T A 9: 39,511,199 I174L probably damaging Het
Pik3c2g T C 6: 139,896,173 L768P probably benign Het
Plod2 T A 9: 92,593,770 V302D possibly damaging Het
Ptgdr A T 14: 44,858,610 V215E possibly damaging Het
Rad51d C T 11: 82,879,333 R199Q probably damaging Het
Rsrc1 C T 3: 66,994,649 P44L unknown Het
Rtel1 ATT ATTTT 2: 181,338,277 probably null Het
Sgip1 A G 4: 102,968,191 R772G probably damaging Het
Slc19a2 C A 1: 164,261,009 T141N probably damaging Het
Sp4 G T 12: 118,299,173 N379K probably damaging Het
Thrap3 A G 4: 126,180,492 probably benign Het
Thumpd2 T G 17: 81,044,114 I293L probably benign Het
Tjp1 A G 7: 65,299,688 S1649P probably damaging Het
Tssk4 A G 14: 55,652,407 S326G probably benign Het
Txndc9 A C 1: 37,995,806 S6A probably benign Het
Uhrf1 T C 17: 56,309,574 Y131H probably damaging Het
Vnn3 A G 10: 23,865,934 D379G possibly damaging Het
Vsig2 T A 9: 37,541,449 S105T probably benign Het
Zfp445 A T 9: 122,862,294 probably null Het
Zfp654 A T 16: 64,786,471 M456K probably damaging Het
Other mutations in Ice1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00904:Ice1 APN 13 70602289 missense probably damaging 1.00
IGL01155:Ice1 APN 13 70604082 missense possibly damaging 0.93
IGL01298:Ice1 APN 13 70604904 missense possibly damaging 0.93
IGL01797:Ice1 APN 13 70623946 missense probably damaging 1.00
IGL02423:Ice1 APN 13 70592599 missense probably damaging 1.00
IGL02583:Ice1 APN 13 70605735 missense possibly damaging 0.80
IGL02794:Ice1 APN 13 70609159 missense possibly damaging 0.95
IGL02882:Ice1 APN 13 70624474 splice site probably benign
IGL02929:Ice1 APN 13 70596203 missense probably damaging 1.00
IGL03343:Ice1 APN 13 70602929 missense probably damaging 1.00
IGL03384:Ice1 APN 13 70603249 missense probably benign 0.00
PIT4651001:Ice1 UTSW 13 70623921 critical splice donor site probably null
R0078:Ice1 UTSW 13 70603348 missense probably damaging 0.98
R0081:Ice1 UTSW 13 70619044 nonsense probably null
R0281:Ice1 UTSW 13 70604047 missense possibly damaging 0.64
R0557:Ice1 UTSW 13 70601191 missense probably benign 0.08
R0973:Ice1 UTSW 13 70602427 missense probably benign 0.04
R0973:Ice1 UTSW 13 70602427 missense probably benign 0.04
R0974:Ice1 UTSW 13 70602427 missense probably benign 0.04
R1033:Ice1 UTSW 13 70606594 missense probably damaging 0.96
R1371:Ice1 UTSW 13 70596221 missense probably damaging 1.00
R1525:Ice1 UTSW 13 70605410 missense probably benign 0.01
R1539:Ice1 UTSW 13 70605904 missense probably damaging 1.00
R1596:Ice1 UTSW 13 70604895 missense possibly damaging 0.94
R1603:Ice1 UTSW 13 70603353 missense probably benign 0.01
R1680:Ice1 UTSW 13 70605448 missense probably benign 0.00
R1737:Ice1 UTSW 13 70606325 missense probably damaging 0.99
R1766:Ice1 UTSW 13 70604442 missense possibly damaging 0.78
R1774:Ice1 UTSW 13 70604553 missense probably damaging 1.00
R1834:Ice1 UTSW 13 70615338 missense probably damaging 0.99
R1840:Ice1 UTSW 13 70606218 missense probably benign 0.00
R1898:Ice1 UTSW 13 70602307 missense possibly damaging 0.83
R1930:Ice1 UTSW 13 70605083 missense probably benign 0.18
R2000:Ice1 UTSW 13 70602427 missense possibly damaging 0.58
R2106:Ice1 UTSW 13 70605622 missense probably benign 0.00
R2293:Ice1 UTSW 13 70614957 missense probably damaging 1.00
R2377:Ice1 UTSW 13 70602780 missense probably damaging 1.00
R2909:Ice1 UTSW 13 70596173 missense probably damaging 1.00
R2965:Ice1 UTSW 13 70602578 missense probably benign 0.31
R3730:Ice1 UTSW 13 70603240 missense probably damaging 1.00
R3886:Ice1 UTSW 13 70605370 missense probably benign 0.00
R3914:Ice1 UTSW 13 70606084 missense probably benign 0.30
R4051:Ice1 UTSW 13 70603527 missense probably damaging 1.00
R4321:Ice1 UTSW 13 70603110 missense possibly damaging 0.83
R4499:Ice1 UTSW 13 70609027 missense possibly damaging 0.87
R4729:Ice1 UTSW 13 70606384 missense probably damaging 1.00
R5078:Ice1 UTSW 13 70604850 missense probably benign
R5431:Ice1 UTSW 13 70592650 missense probably damaging 1.00
R5722:Ice1 UTSW 13 70615100 missense possibly damaging 0.95
R5881:Ice1 UTSW 13 70606501 missense probably benign 0.04
R5914:Ice1 UTSW 13 70606377 missense possibly damaging 0.93
R6171:Ice1 UTSW 13 70606731 missense probably benign
R6253:Ice1 UTSW 13 70603164 missense probably damaging 1.00
R6274:Ice1 UTSW 13 70594839 missense probably damaging 0.97
R6518:Ice1 UTSW 13 70606309 missense possibly damaging 0.89
R6665:Ice1 UTSW 13 70603473 missense possibly damaging 0.85
R6714:Ice1 UTSW 13 70615263 splice site probably null
R6853:Ice1 UTSW 13 70603302 missense possibly damaging 0.92
R7032:Ice1 UTSW 13 70596164 missense probably damaging 0.99
R7176:Ice1 UTSW 13 70624406 critical splice donor site probably null
R7352:Ice1 UTSW 13 70606102 nonsense probably null
R7445:Ice1 UTSW 13 70596167 missense
R7646:Ice1 UTSW 13 70589797 missense possibly damaging 0.93
R7647:Ice1 UTSW 13 70589797 missense possibly damaging 0.93
R7648:Ice1 UTSW 13 70589797 missense possibly damaging 0.93
R7650:Ice1 UTSW 13 70589797 missense possibly damaging 0.93
R7650:Ice1 UTSW 13 70605483 missense probably damaging 1.00
R7812:Ice1 UTSW 13 70603005 missense possibly damaging 0.63
R8061:Ice1 UTSW 13 70603732 missense probably damaging 1.00
R8129:Ice1 UTSW 13 70606201 missense probably benign 0.02
R8283:Ice1 UTSW 13 70604430 missense probably damaging 0.97
R8303:Ice1 UTSW 13 70606407 missense probably benign 0.04
R8444:Ice1 UTSW 13 70604376 missense probably damaging 1.00
R8474:Ice1 UTSW 13 70604447 missense probably benign 0.42
R8751:Ice1 UTSW 13 70602891 missense probably damaging 1.00
R8887:Ice1 UTSW 13 70602931 missense probably damaging 1.00
R8911:Ice1 UTSW 13 70592668 missense
R8954:Ice1 UTSW 13 70610578 missense probably damaging 1.00
R9345:Ice1 UTSW 13 70592639 missense
R9438:Ice1 UTSW 13 70606315 missense probably benign 0.04
R9452:Ice1 UTSW 13 70596343 missense probably damaging 1.00
X0026:Ice1 UTSW 13 70592602 missense probably damaging 1.00
Z1176:Ice1 UTSW 13 70605201 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGTGTATGTGTCAACACCAC -3'
(R):5'- TGCCAGGATCCTTTCAGTGG -3'

Sequencing Primer
(F):5'- GTGTATGTGTCAACACCACACTTAG -3'
(R):5'- GGAAGTACTATTCTTTCACCATGTC -3'
Posted On 2018-11-06