Incidental Mutation 'R6918:Mixl1'
ID539427
Institutional Source Beutler Lab
Gene Symbol Mixl1
Ensembl Gene ENSMUSG00000026497
Gene NameMix1 homeobox-like 1 (Xenopus laevis)
SynonymsMml
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6918 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location180693043-180697034 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 180694678 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 213 (I213F)
Ref Sequence ENSEMBL: ENSMUSP00000027778 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027778] [ENSMUST00000192561] [ENSMUST00000192725] [ENSMUST00000193892]
Predicted Effect probably benign
Transcript: ENSMUST00000027778
AA Change: I213F

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000027778
Gene: ENSMUSG00000026497
AA Change: I213F

DomainStartEndE-ValueType
low complexity region 72 85 N/A INTRINSIC
HOX 86 148 1.58e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000192561
SMART Domains Protein: ENSMUSP00000141331
Gene: ENSMUSG00000058729

DomainStartEndE-ValueType
DIRP 143 248 2.2e-71 SMART
coiled coil region 370 428 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000192725
SMART Domains Protein: ENSMUSP00000141503
Gene: ENSMUSG00000058729

DomainStartEndE-ValueType
DIRP 103 208 2.2e-71 SMART
coiled coil region 330 388 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193892
SMART Domains Protein: ENSMUSP00000141530
Gene: ENSMUSG00000058729

DomainStartEndE-ValueType
DIRP 127 232 2.2e-71 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.2%
Validation Efficiency 100% (48/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Homeodomain proteins, such as MIXL1, are transcription factors that regulate cell fate during development (Hart et al., 2005 [PubMed 15982639]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Homozygous null embryos are mostly arrested in development by E9 exhibiting abnormalities in primitive streak and node formation, disorganized head folds, foreshortened body axis, absence of heart tube and gut, deficient paraxial mesoderm, abnormal notochord morphology, and an enlarged allantois. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210011C24Rik T G 8: 84,011,684 M1L probably benign Het
Abca3 A C 17: 24,408,658 K1359Q probably damaging Het
Ace T C 11: 105,972,943 Y406H probably damaging Het
Acsl6 A G 11: 54,341,756 probably null Het
Alms1 T A 6: 85,622,661 Y1959N possibly damaging Het
BC037034 A G 5: 138,260,664 V211A probably benign Het
Chrna7 T A 7: 63,159,551 I76F probably benign Het
Cuedc1 C T 11: 88,187,073 T296I probably benign Het
Ddc A G 11: 11,819,307 V409A probably damaging Het
Dhx8 T A 11: 101,738,421 Y212* probably null Het
Dnah6 T A 6: 73,181,755 K622* probably null Het
Dscaml1 A G 9: 45,430,507 H72R probably benign Het
Dyrk1b A G 7: 28,185,925 D396G probably damaging Het
Gstm2 A G 3: 107,985,241 probably null Het
Hsd3b1 A G 3: 98,853,109 Y189H probably damaging Het
Kif1c G A 11: 70,706,987 E356K probably damaging Het
Kirrel2 A C 7: 30,450,814 C17G probably damaging Het
Klhl12 A G 1: 134,475,846 H259R possibly damaging Het
Krt1 A G 15: 101,850,177 V184A probably damaging Het
Lmod2 A T 6: 24,603,595 N190Y probably benign Het
Lrp2 A C 2: 69,489,305 V1958G probably damaging Het
Ly6h T C 15: 75,565,658 S37G probably damaging Het
Man2a2 A T 7: 80,353,192 H1056Q possibly damaging Het
Morc3 T C 16: 93,853,135 I268T probably benign Het
Mtx2 C T 2: 74,876,353 T224I probably damaging Het
Olfr893 G A 9: 38,209,652 V198M possibly damaging Het
Oscp1 A C 4: 126,076,778 D120A possibly damaging Het
Parp1 G A 1: 180,588,670 V545I possibly damaging Het
Pipox A G 11: 77,881,554 I330T probably damaging Het
Pkp2 A G 16: 16,272,218 Y790C probably damaging Het
Pomt1 T A 2: 32,252,861 probably null Het
Pp2d1 G A 17: 53,515,459 T193M probably damaging Het
Prkra G T 2: 76,630,453 H300Q probably damaging Het
Ror2 T G 13: 53,111,451 N523T probably damaging Het
Rp1 A T 1: 3,999,608 D1355E unknown Het
Rsph4a T C 10: 33,905,276 Y41H probably benign Het
Scn1a T A 2: 66,332,213 I230F probably damaging Het
Taar7e T A 10: 24,037,615 M1K probably null Het
Tex15 T G 8: 33,573,184 L1155V probably benign Het
Tmprss3 T C 17: 31,188,357 K321E probably benign Het
Tsc2 A T 17: 24,613,229 C728S probably damaging Het
Ube2e3 A T 2: 78,920,039 K203M probably damaging Het
Unc50 A T 1: 37,438,702 T222S probably damaging Het
Vmn1r236 A T 17: 21,287,616 H332L probably benign Het
Vmn2r7 G A 3: 64,691,339 T599I probably benign Het
Zfp334 A T 2: 165,381,879 D81E possibly damaging Het
Zfp710 A G 7: 80,082,040 I322V possibly damaging Het
Other mutations in Mixl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02548:Mixl1 APN 1 180694704 missense probably benign 0.03
IGL03371:Mixl1 APN 1 180694626 missense probably benign 0.00
R0453:Mixl1 UTSW 1 180696646 missense probably damaging 1.00
R0838:Mixl1 UTSW 1 180696800 missense probably benign 0.45
R1832:Mixl1 UTSW 1 180694731 missense probably benign 0.11
R4870:Mixl1 UTSW 1 180694672 missense probably benign 0.06
R6046:Mixl1 UTSW 1 180696771 missense possibly damaging 0.94
R6980:Mixl1 UTSW 1 180696888 missense possibly damaging 0.51
R7047:Mixl1 UTSW 1 180696618 critical splice donor site probably null
R7296:Mixl1 UTSW 1 180696958 missense probably benign
X0065:Mixl1 UTSW 1 180694701 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCAGTAAAGGCTCAGTGTCAG -3'
(R):5'- AGAGTGGGAAGTCATTTCAGC -3'

Sequencing Primer
(F):5'- CTCAGTGTCAGAGAAGGGAACC -3'
(R):5'- AGTGGGAAGTCATTTCAGCCCTTATC -3'
Posted On2018-11-06