Incidental Mutation 'R6918:Ube2e3'
ID539433
Institutional Source Beutler Lab
Gene Symbol Ube2e3
Ensembl Gene ENSMUSG00000027011
Gene Nameubiquitin-conjugating enzyme E2E 3
SynonymsubcM2, Ubce4
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.583) question?
Stock #R6918 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location78868124-78921293 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 78920039 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Methionine at position 203 (K203M)
Ref Sequence ENSEMBL: ENSMUSP00000113463 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028398] [ENSMUST00000121433]
Predicted Effect probably damaging
Transcript: ENSMUST00000028398
AA Change: K203M

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000028398
Gene: ENSMUSG00000027011
AA Change: K203M

DomainStartEndE-ValueType
low complexity region 8 38 N/A INTRINSIC
UBCc 64 207 3.91e-71 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000121433
AA Change: K203M

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000113463
Gene: ENSMUSG00000027011
AA Change: K203M

DomainStartEndE-ValueType
low complexity region 8 38 N/A INTRINSIC
UBCc 64 207 3.91e-71 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.2%
Validation Efficiency 100% (48/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The modification of proteins with ubiquitin is an important cellular mechanism for targeting abnormal or short-lived proteins for degradation. Ubiquitination involves at least three classes of enzymes: ubiquitin-activating enzymes, or E1s, ubiquitin-conjugating enzymes, or E2s, and ubiquitin-protein ligases, or E3s. This gene encodes a member of the E2 ubiquitin-conjugating enzyme family. The encoded protein shares 100% sequence identity with the mouse and rat counterparts, which indicates that this enzyme is highly conserved in eukaryotes. Multiple alternatively spliced transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jun 2013]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210011C24Rik T G 8: 84,011,684 M1L probably benign Het
Abca3 A C 17: 24,408,658 K1359Q probably damaging Het
Ace T C 11: 105,972,943 Y406H probably damaging Het
Acsl6 A G 11: 54,341,756 probably null Het
Alms1 T A 6: 85,622,661 Y1959N possibly damaging Het
BC037034 A G 5: 138,260,664 V211A probably benign Het
Chrna7 T A 7: 63,159,551 I76F probably benign Het
Cuedc1 C T 11: 88,187,073 T296I probably benign Het
Ddc A G 11: 11,819,307 V409A probably damaging Het
Dhx8 T A 11: 101,738,421 Y212* probably null Het
Dnah6 T A 6: 73,181,755 K622* probably null Het
Dscaml1 A G 9: 45,430,507 H72R probably benign Het
Dyrk1b A G 7: 28,185,925 D396G probably damaging Het
Gstm2 A G 3: 107,985,241 probably null Het
Hsd3b1 A G 3: 98,853,109 Y189H probably damaging Het
Kif1c G A 11: 70,706,987 E356K probably damaging Het
Kirrel2 A C 7: 30,450,814 C17G probably damaging Het
Klhl12 A G 1: 134,475,846 H259R possibly damaging Het
Krt1 A G 15: 101,850,177 V184A probably damaging Het
Lmod2 A T 6: 24,603,595 N190Y probably benign Het
Lrp2 A C 2: 69,489,305 V1958G probably damaging Het
Ly6h T C 15: 75,565,658 S37G probably damaging Het
Man2a2 A T 7: 80,353,192 H1056Q possibly damaging Het
Mixl1 T A 1: 180,694,678 I213F probably benign Het
Morc3 T C 16: 93,853,135 I268T probably benign Het
Mtx2 C T 2: 74,876,353 T224I probably damaging Het
Olfr893 G A 9: 38,209,652 V198M possibly damaging Het
Oscp1 A C 4: 126,076,778 D120A possibly damaging Het
Parp1 G A 1: 180,588,670 V545I possibly damaging Het
Pipox A G 11: 77,881,554 I330T probably damaging Het
Pkp2 A G 16: 16,272,218 Y790C probably damaging Het
Pomt1 T A 2: 32,252,861 probably null Het
Pp2d1 G A 17: 53,515,459 T193M probably damaging Het
Prkra G T 2: 76,630,453 H300Q probably damaging Het
Ror2 T G 13: 53,111,451 N523T probably damaging Het
Rp1 A T 1: 3,999,608 D1355E unknown Het
Rsph4a T C 10: 33,905,276 Y41H probably benign Het
Scn1a T A 2: 66,332,213 I230F probably damaging Het
Taar7e T A 10: 24,037,615 M1K probably null Het
Tex15 T G 8: 33,573,184 L1155V probably benign Het
Tmprss3 T C 17: 31,188,357 K321E probably benign Het
Tsc2 A T 17: 24,613,229 C728S probably damaging Het
Unc50 A T 1: 37,438,702 T222S probably damaging Het
Vmn1r236 A T 17: 21,287,616 H332L probably benign Het
Vmn2r7 G A 3: 64,691,339 T599I probably benign Het
Zfp334 A T 2: 165,381,879 D81E possibly damaging Het
Zfp710 A G 7: 80,082,040 I322V possibly damaging Het
Other mutations in Ube2e3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02619:Ube2e3 APN 2 78918721 missense probably damaging 1.00
R0069:Ube2e3 UTSW 2 78919949 splice site probably benign
R0069:Ube2e3 UTSW 2 78919949 splice site probably benign
R0586:Ube2e3 UTSW 2 78919990 missense probably benign 0.41
R4609:Ube2e3 UTSW 2 78918712 missense probably damaging 1.00
R7136:Ube2e3 UTSW 2 78913741 missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- TGCTGCCAAACTGTAGCTG -3'
(R):5'- GATATCCCAAAGAAGCAAGACTTG -3'

Sequencing Primer
(F):5'- ACTTTTCCAGCGGATCC -3'
(R):5'- CTACAGCTACAAAGTTCTACTCTTGG -3'
Posted On2018-11-06