Incidental Mutation 'R6918:Hsd3b1'
ID539436
Institutional Source Beutler Lab
Gene Symbol Hsd3b1
Ensembl Gene ENSMUSG00000027871
Gene Namehydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 1
SynonymsD3Ertd383e
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.115) question?
Stock #R6918 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location98852194-98859794 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 98853109 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 189 (Y189H)
Ref Sequence ENSEMBL: ENSMUSP00000102630 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029465] [ENSMUST00000107016]
Predicted Effect probably damaging
Transcript: ENSMUST00000029465
AA Change: Y189H

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000029465
Gene: ENSMUSG00000027871
AA Change: Y189H

DomainStartEndE-ValueType
Pfam:Epimerase 24 248 3.8e-23 PFAM
Pfam:NAD_binding_4 25 226 3.4e-18 PFAM
Pfam:Polysacc_synt_2 30 129 1.3e-8 PFAM
Pfam:3Beta_HSD 34 282 1.8e-102 PFAM
Pfam:NAD_binding_10 35 228 1.7e-8 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000107016
AA Change: Y189H

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000102630
Gene: ENSMUSG00000027871
AA Change: Y189H

DomainStartEndE-ValueType
Pfam:RmlD_sub_bind 4 264 4.3e-8 PFAM
Pfam:KR 5 133 1.1e-7 PFAM
Pfam:Ldh_1_N 5 135 4.3e-7 PFAM
Pfam:Polysacc_synt_2 6 136 3e-14 PFAM
Pfam:NmrA 6 138 6.2e-10 PFAM
Pfam:Epimerase 6 250 2.9e-30 PFAM
Pfam:GDP_Man_Dehyd 7 216 6.6e-16 PFAM
Pfam:3Beta_HSD 7 288 2.1e-122 PFAM
Pfam:NAD_binding_4 8 219 4e-21 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.2%
Validation Efficiency 100% (48/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a bifunctional enzyme that catalyzes the oxidative conversion of delta(5)-ene-3-beta-hydroxy steroid, and the oxidative conversion of ketosteroids. It plays a crucial role in the biosynthesis of all classes of hormonal steroids. This gene is predominantly expressed in the adrenals and the gonads. Mutations in this gene are associated with 3-beta-hydroxysteroid dehydrogenase, type II, deficiency. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Oct 2009]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210011C24Rik T G 8: 84,011,684 M1L probably benign Het
Abca3 A C 17: 24,408,658 K1359Q probably damaging Het
Ace T C 11: 105,972,943 Y406H probably damaging Het
Acsl6 A G 11: 54,341,756 probably null Het
Alms1 T A 6: 85,622,661 Y1959N possibly damaging Het
BC037034 A G 5: 138,260,664 V211A probably benign Het
Chrna7 T A 7: 63,159,551 I76F probably benign Het
Cuedc1 C T 11: 88,187,073 T296I probably benign Het
Ddc A G 11: 11,819,307 V409A probably damaging Het
Dhx8 T A 11: 101,738,421 Y212* probably null Het
Dnah6 T A 6: 73,181,755 K622* probably null Het
Dscaml1 A G 9: 45,430,507 H72R probably benign Het
Dyrk1b A G 7: 28,185,925 D396G probably damaging Het
Gstm2 A G 3: 107,985,241 probably null Het
Kif1c G A 11: 70,706,987 E356K probably damaging Het
Kirrel2 A C 7: 30,450,814 C17G probably damaging Het
Klhl12 A G 1: 134,475,846 H259R possibly damaging Het
Krt1 A G 15: 101,850,177 V184A probably damaging Het
Lmod2 A T 6: 24,603,595 N190Y probably benign Het
Lrp2 A C 2: 69,489,305 V1958G probably damaging Het
Ly6h T C 15: 75,565,658 S37G probably damaging Het
Man2a2 A T 7: 80,353,192 H1056Q possibly damaging Het
Mixl1 T A 1: 180,694,678 I213F probably benign Het
Morc3 T C 16: 93,853,135 I268T probably benign Het
Mtx2 C T 2: 74,876,353 T224I probably damaging Het
Olfr893 G A 9: 38,209,652 V198M possibly damaging Het
Oscp1 A C 4: 126,076,778 D120A possibly damaging Het
Parp1 G A 1: 180,588,670 V545I possibly damaging Het
Pipox A G 11: 77,881,554 I330T probably damaging Het
Pkp2 A G 16: 16,272,218 Y790C probably damaging Het
Pomt1 T A 2: 32,252,861 probably null Het
Pp2d1 G A 17: 53,515,459 T193M probably damaging Het
Prkra G T 2: 76,630,453 H300Q probably damaging Het
Ror2 T G 13: 53,111,451 N523T probably damaging Het
Rp1 A T 1: 3,999,608 D1355E unknown Het
Rsph4a T C 10: 33,905,276 Y41H probably benign Het
Scn1a T A 2: 66,332,213 I230F probably damaging Het
Taar7e T A 10: 24,037,615 M1K probably null Het
Tex15 T G 8: 33,573,184 L1155V probably benign Het
Tmprss3 T C 17: 31,188,357 K321E probably benign Het
Tsc2 A T 17: 24,613,229 C728S probably damaging Het
Ube2e3 A T 2: 78,920,039 K203M probably damaging Het
Unc50 A T 1: 37,438,702 T222S probably damaging Het
Vmn1r236 A T 17: 21,287,616 H332L probably benign Het
Vmn2r7 G A 3: 64,691,339 T599I probably benign Het
Zfp334 A T 2: 165,381,879 D81E possibly damaging Het
Zfp710 A G 7: 80,082,040 I322V possibly damaging Het
Other mutations in Hsd3b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00534:Hsd3b1 APN 3 98853246 missense probably damaging 1.00
IGL01955:Hsd3b1 APN 3 98853147 missense probably benign 0.08
IGL02894:Hsd3b1 APN 3 98852929 missense possibly damaging 0.88
IGL03136:Hsd3b1 APN 3 98852985 missense probably damaging 1.00
R0265:Hsd3b1 UTSW 3 98852773 missense probably damaging 1.00
R0326:Hsd3b1 UTSW 3 98853274 missense probably damaging 1.00
R0390:Hsd3b1 UTSW 3 98853039 missense probably damaging 1.00
R1532:Hsd3b1 UTSW 3 98852898 missense probably damaging 1.00
R2845:Hsd3b1 UTSW 3 98852778 missense probably damaging 1.00
R2846:Hsd3b1 UTSW 3 98852778 missense probably damaging 1.00
R2898:Hsd3b1 UTSW 3 98853307 missense probably benign 0.00
R3153:Hsd3b1 UTSW 3 98852664 missense probably damaging 0.99
R3950:Hsd3b1 UTSW 3 98856138 missense possibly damaging 0.79
R4456:Hsd3b1 UTSW 3 98856143 missense probably benign 0.01
R4792:Hsd3b1 UTSW 3 98852910 missense probably benign 0.22
R4799:Hsd3b1 UTSW 3 98852865 missense probably benign 0.07
R4898:Hsd3b1 UTSW 3 98853326 missense probably benign 0.12
R5512:Hsd3b1 UTSW 3 98853205 missense probably benign 0.06
R5834:Hsd3b1 UTSW 3 98852939 missense possibly damaging 0.60
R5921:Hsd3b1 UTSW 3 98857899 missense probably benign 0.06
R6221:Hsd3b1 UTSW 3 98853156 missense probably benign 0.00
R7058:Hsd3b1 UTSW 3 98857815 splice site probably null
R7242:Hsd3b1 UTSW 3 98853210 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTTCTTGGGGTCTCGAAGG -3'
(R):5'- AGGCCTGTGTTCAAGCAAGTG -3'

Sequencing Primer
(F):5'- GTCTCGAAGGCCCCTGG -3'
(R):5'- TTGATGTTGCAGGGCCCAAC -3'
Posted On2018-11-06