Incidental Mutation 'R6918:Lmod2'
ID539440
Institutional Source Beutler Lab
Gene Symbol Lmod2
Ensembl Gene ENSMUSG00000029683
Gene Nameleiomodin 2 (cardiac)
SynonymsC-Lmod
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.117) question?
Stock #R6918 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location24597762-24605414 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 24603595 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Tyrosine at position 190 (N190Y)
Ref Sequence ENSEMBL: ENSMUSP00000031694 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031694]
Predicted Effect probably benign
Transcript: ENSMUST00000031694
AA Change: N190Y

PolyPhen 2 Score 0.226 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000031694
Gene: ENSMUSG00000029683
AA Change: N190Y

DomainStartEndE-ValueType
Pfam:Tropomodulin 6 153 9.7e-19 PFAM
PDB:1IO0|A 202 360 5e-45 PDB
low complexity region 361 374 N/A INTRINSIC
low complexity region 403 414 N/A INTRINSIC
low complexity region 421 453 N/A INTRINSIC
low complexity region 482 490 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.2%
Validation Efficiency 100% (48/48)
MGI Phenotype PHENOTYPE: Homozygous disruption of this gene results in thin filaments in the heart, cardiac contractile dysfunction, abnormal myocardial fiber ultrastucture, dilated cardiomyopathy, and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210011C24Rik T G 8: 84,011,684 M1L probably benign Het
Abca3 A C 17: 24,408,658 K1359Q probably damaging Het
Ace T C 11: 105,972,943 Y406H probably damaging Het
Acsl6 A G 11: 54,341,756 probably null Het
Alms1 T A 6: 85,622,661 Y1959N possibly damaging Het
BC037034 A G 5: 138,260,664 V211A probably benign Het
Chrna7 T A 7: 63,159,551 I76F probably benign Het
Cuedc1 C T 11: 88,187,073 T296I probably benign Het
Ddc A G 11: 11,819,307 V409A probably damaging Het
Dhx8 T A 11: 101,738,421 Y212* probably null Het
Dnah6 T A 6: 73,181,755 K622* probably null Het
Dscaml1 A G 9: 45,430,507 H72R probably benign Het
Dyrk1b A G 7: 28,185,925 D396G probably damaging Het
Gstm2 A G 3: 107,985,241 probably null Het
Hsd3b1 A G 3: 98,853,109 Y189H probably damaging Het
Kif1c G A 11: 70,706,987 E356K probably damaging Het
Kirrel2 A C 7: 30,450,814 C17G probably damaging Het
Klhl12 A G 1: 134,475,846 H259R possibly damaging Het
Krt1 A G 15: 101,850,177 V184A probably damaging Het
Lrp2 A C 2: 69,489,305 V1958G probably damaging Het
Ly6h T C 15: 75,565,658 S37G probably damaging Het
Man2a2 A T 7: 80,353,192 H1056Q possibly damaging Het
Mixl1 T A 1: 180,694,678 I213F probably benign Het
Morc3 T C 16: 93,853,135 I268T probably benign Het
Mtx2 C T 2: 74,876,353 T224I probably damaging Het
Olfr893 G A 9: 38,209,652 V198M possibly damaging Het
Oscp1 A C 4: 126,076,778 D120A possibly damaging Het
Parp1 G A 1: 180,588,670 V545I possibly damaging Het
Pipox A G 11: 77,881,554 I330T probably damaging Het
Pkp2 A G 16: 16,272,218 Y790C probably damaging Het
Pomt1 T A 2: 32,252,861 probably null Het
Pp2d1 G A 17: 53,515,459 T193M probably damaging Het
Prkra G T 2: 76,630,453 H300Q probably damaging Het
Ror2 T G 13: 53,111,451 N523T probably damaging Het
Rp1 A T 1: 3,999,608 D1355E unknown Het
Rsph4a T C 10: 33,905,276 Y41H probably benign Het
Scn1a T A 2: 66,332,213 I230F probably damaging Het
Taar7e T A 10: 24,037,615 M1K probably null Het
Tex15 T G 8: 33,573,184 L1155V probably benign Het
Tmprss3 T C 17: 31,188,357 K321E probably benign Het
Tsc2 A T 17: 24,613,229 C728S probably damaging Het
Ube2e3 A T 2: 78,920,039 K203M probably damaging Het
Unc50 A T 1: 37,438,702 T222S probably damaging Het
Vmn1r236 A T 17: 21,287,616 H332L probably benign Het
Vmn2r7 G A 3: 64,691,339 T599I probably benign Het
Zfp334 A T 2: 165,381,879 D81E possibly damaging Het
Zfp710 A G 7: 80,082,040 I322V possibly damaging Het
Other mutations in Lmod2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Lmod2 APN 6 24598052 missense probably damaging 1.00
IGL01013:Lmod2 APN 6 24604135 missense probably damaging 0.98
IGL02164:Lmod2 APN 6 24603910 missense possibly damaging 0.89
IGL02328:Lmod2 APN 6 24603833 missense probably benign 0.00
IGL02956:Lmod2 APN 6 24603632 missense probably damaging 1.00
IGL03213:Lmod2 APN 6 24603616 missense possibly damaging 0.88
IGL03351:Lmod2 APN 6 24598016 missense probably benign 0.00
P0035:Lmod2 UTSW 6 24597886 missense probably damaging 1.00
R1764:Lmod2 UTSW 6 24603377 missense probably damaging 0.99
R3104:Lmod2 UTSW 6 24604472 missense probably damaging 1.00
R3955:Lmod2 UTSW 6 24603871 missense probably benign 0.02
R4410:Lmod2 UTSW 6 24604630 missense probably damaging 1.00
R4876:Lmod2 UTSW 6 24604279 missense probably benign 0.06
R4957:Lmod2 UTSW 6 24603872 missense possibly damaging 0.63
R5509:Lmod2 UTSW 6 24603889 missense probably damaging 1.00
R5655:Lmod2 UTSW 6 24603854 missense possibly damaging 0.65
R6114:Lmod2 UTSW 6 24603692 missense probably damaging 1.00
R6462:Lmod2 UTSW 6 24604301 missense probably benign 0.06
R6834:Lmod2 UTSW 6 24597783 start gained probably benign
R6869:Lmod2 UTSW 6 24604127 missense probably benign 0.06
R6909:Lmod2 UTSW 6 24604158 missense probably benign 0.00
R7352:Lmod2 UTSW 6 24598111 missense possibly damaging 0.84
R7425:Lmod2 UTSW 6 24603476 missense probably benign
R7476:Lmod2 UTSW 6 24597921 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACAGCGAAGTCTCTGAGGAG -3'
(R):5'- TGTTCTCCTTGAGAGCTTCAG -3'

Sequencing Primer
(F):5'- TCTCTGAGGAGGTGTGTACAGAAG -3'
(R):5'- TCCTTGAGAGCTTCAGCAAATCG -3'
Posted On2018-11-06