Incidental Mutation 'R6918:Chrna7'
ID539444
Institutional Source Beutler Lab
Gene Symbol Chrna7
Ensembl Gene ENSMUSG00000030525
Gene Namecholinergic receptor, nicotinic, alpha polypeptide 7
Synonymsalpha7-nAChR, alpha7, Acra7, alpha7 nicotinic receptor
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6918 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location63098692-63212569 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 63159551 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 76 (I76F)
Ref Sequence ENSEMBL: ENSMUSP00000032738 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032738]
Predicted Effect probably benign
Transcript: ENSMUST00000032738
AA Change: I76F

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000032738
Gene: ENSMUSG00000030525
AA Change: I76F

DomainStartEndE-ValueType
low complexity region 10 17 N/A INTRINSIC
Pfam:Neur_chan_LBD 26 230 1e-75 PFAM
Pfam:Neur_chan_memb 237 487 3.6e-63 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.2%
Validation Efficiency 100% (48/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The nicotinic acetylcholine receptors (nAChRs) are members of a superfamily of ligand-gated ion channels that mediate fast signal transmission at synapses. The nAChRs are thought to be hetero-pentamers composed of homologous subunits. The proposed structure for each subunit is a conserved N-terminal extracellular domain followed by three conserved transmembrane domains, a variable cytoplasmic loop, a fourth conserved transmembrane domain, and a short C-terminal extracellular region. The protein encoded by this gene forms a homo-oligomeric channel, displays marked permeability to calcium ions and is a major component of brain nicotinic receptors that are blocked by, and highly sensitive to, alpha-bungarotoxin. Once this receptor binds acetylcholine, it undergoes an extensive change in conformation that affects all subunits and leads to opening of an ion-conducting channel across the plasma membrane. This gene is located in a region identified as a major susceptibility locus for juvenile myoclonic epilepsy and a chromosomal location involved in the genetic transmission of schizophrenia. An evolutionarily recent partial duplication event in this region results in a hybrid containing sequence from this gene and a novel FAM7A gene. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2012]
PHENOTYPE: Nullizygous mice lack hippocampal fast nicotinic currents but show nicotine-induced seizures as well as altered anxiety behavior, fertility defects, airway basal cell hyperplasia. and higher TNF sythesis when endotoxemic. Newborns homozygous for a knock-in allele die with increased neuron apoptosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210011C24Rik T G 8: 84,011,684 M1L probably benign Het
Abca3 A C 17: 24,408,658 K1359Q probably damaging Het
Ace T C 11: 105,972,943 Y406H probably damaging Het
Acsl6 A G 11: 54,341,756 probably null Het
Alms1 T A 6: 85,622,661 Y1959N possibly damaging Het
BC037034 A G 5: 138,260,664 V211A probably benign Het
Cuedc1 C T 11: 88,187,073 T296I probably benign Het
Ddc A G 11: 11,819,307 V409A probably damaging Het
Dhx8 T A 11: 101,738,421 Y212* probably null Het
Dnah6 T A 6: 73,181,755 K622* probably null Het
Dscaml1 A G 9: 45,430,507 H72R probably benign Het
Dyrk1b A G 7: 28,185,925 D396G probably damaging Het
Gstm2 A G 3: 107,985,241 probably null Het
Hsd3b1 A G 3: 98,853,109 Y189H probably damaging Het
Kif1c G A 11: 70,706,987 E356K probably damaging Het
Kirrel2 A C 7: 30,450,814 C17G probably damaging Het
Klhl12 A G 1: 134,475,846 H259R possibly damaging Het
Krt1 A G 15: 101,850,177 V184A probably damaging Het
Lmod2 A T 6: 24,603,595 N190Y probably benign Het
Lrp2 A C 2: 69,489,305 V1958G probably damaging Het
Ly6h T C 15: 75,565,658 S37G probably damaging Het
Man2a2 A T 7: 80,353,192 H1056Q possibly damaging Het
Mixl1 T A 1: 180,694,678 I213F probably benign Het
Morc3 T C 16: 93,853,135 I268T probably benign Het
Mtx2 C T 2: 74,876,353 T224I probably damaging Het
Olfr893 G A 9: 38,209,652 V198M possibly damaging Het
Oscp1 A C 4: 126,076,778 D120A possibly damaging Het
Parp1 G A 1: 180,588,670 V545I possibly damaging Het
Pipox A G 11: 77,881,554 I330T probably damaging Het
Pkp2 A G 16: 16,272,218 Y790C probably damaging Het
Pomt1 T A 2: 32,252,861 probably null Het
Pp2d1 G A 17: 53,515,459 T193M probably damaging Het
Prkra G T 2: 76,630,453 H300Q probably damaging Het
Ror2 T G 13: 53,111,451 N523T probably damaging Het
Rp1 A T 1: 3,999,608 D1355E unknown Het
Rsph4a T C 10: 33,905,276 Y41H probably benign Het
Scn1a T A 2: 66,332,213 I230F probably damaging Het
Taar7e T A 10: 24,037,615 M1K probably null Het
Tex15 T G 8: 33,573,184 L1155V probably benign Het
Tmprss3 T C 17: 31,188,357 K321E probably benign Het
Tsc2 A T 17: 24,613,229 C728S probably damaging Het
Ube2e3 A T 2: 78,920,039 K203M probably damaging Het
Unc50 A T 1: 37,438,702 T222S probably damaging Het
Vmn1r236 A T 17: 21,287,616 H332L probably benign Het
Vmn2r7 G A 3: 64,691,339 T599I probably benign Het
Zfp334 A T 2: 165,381,879 D81E possibly damaging Het
Zfp710 A G 7: 80,082,040 I322V possibly damaging Het
Other mutations in Chrna7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01776:Chrna7 APN 7 63099519 missense probably benign 0.01
IGL01999:Chrna7 APN 7 63103791 missense probably damaging 1.00
IGL02016:Chrna7 APN 7 63103835 missense probably damaging 1.00
IGL02388:Chrna7 APN 7 63107691 missense probably damaging 1.00
IGL02400:Chrna7 APN 7 63099322 missense probably damaging 1.00
IGL02458:Chrna7 APN 7 63106094 missense probably damaging 1.00
IGL03039:Chrna7 APN 7 63148592 missense probably damaging 1.00
inflation UTSW 7 63148601 missense probably damaging 1.00
R0034:Chrna7 UTSW 7 63148606 missense possibly damaging 0.79
R0631:Chrna7 UTSW 7 63099643 missense probably benign 0.00
R1666:Chrna7 UTSW 7 63212142 missense possibly damaging 0.70
R1703:Chrna7 UTSW 7 63099507 missense probably damaging 0.99
R1763:Chrna7 UTSW 7 63099252 missense probably benign 0.05
R1974:Chrna7 UTSW 7 63099286 missense probably damaging 1.00
R2294:Chrna7 UTSW 7 63110424 missense probably benign 0.11
R2393:Chrna7 UTSW 7 63099246 missense probably damaging 1.00
R4598:Chrna7 UTSW 7 63103790 missense probably damaging 1.00
R4599:Chrna7 UTSW 7 63103790 missense probably damaging 1.00
R4842:Chrna7 UTSW 7 63212448 missense probably benign 0.05
R5143:Chrna7 UTSW 7 63106147 missense probably damaging 1.00
R5310:Chrna7 UTSW 7 63106057 missense probably damaging 1.00
R5339:Chrna7 UTSW 7 63099307 missense probably damaging 1.00
R5516:Chrna7 UTSW 7 63099298 missense probably damaging 0.98
R5807:Chrna7 UTSW 7 63148601 missense probably damaging 1.00
R6501:Chrna7 UTSW 7 63106115 missense probably damaging 1.00
R7000:Chrna7 UTSW 7 63106039 missense probably damaging 1.00
R7189:Chrna7 UTSW 7 63106027 missense probably damaging 1.00
R7483:Chrna7 UTSW 7 63104990 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTCAGGCTCTCATCCTTGG -3'
(R):5'- ACTCTCGGGAAATGTTACTGG -3'

Sequencing Primer
(F):5'- TTGGCTCCATCCTATCAAACATAG -3'
(R):5'- ACTCTCGGGAAATGTTACTGGCATAG -3'
Posted On2018-11-06