Incidental Mutation 'R6918:Pipox'
ID539455
Institutional Source Beutler Lab
Gene Symbol Pipox
Ensembl Gene ENSMUSG00000017453
Gene Namepipecolic acid oxidase
SynonymsPso
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6918 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location77880615-77894096 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 77881554 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 330 (I330T)
Ref Sequence ENSEMBL: ENSMUSP00000017597 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017597]
Predicted Effect probably damaging
Transcript: ENSMUST00000017597
AA Change: I330T

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000017597
Gene: ENSMUSG00000017453
AA Change: I330T

DomainStartEndE-ValueType
Pfam:DAO 9 364 3.1e-49 PFAM
Pfam:NAD_binding_8 12 54 1.2e-6 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.2%
Validation Efficiency 100% (48/48)
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210011C24Rik T G 8: 84,011,684 M1L probably benign Het
Abca3 A C 17: 24,408,658 K1359Q probably damaging Het
Ace T C 11: 105,972,943 Y406H probably damaging Het
Acsl6 A G 11: 54,341,756 probably null Het
Alms1 T A 6: 85,622,661 Y1959N possibly damaging Het
BC037034 A G 5: 138,260,664 V211A probably benign Het
Chrna7 T A 7: 63,159,551 I76F probably benign Het
Cuedc1 C T 11: 88,187,073 T296I probably benign Het
Ddc A G 11: 11,819,307 V409A probably damaging Het
Dhx8 T A 11: 101,738,421 Y212* probably null Het
Dnah6 T A 6: 73,181,755 K622* probably null Het
Dscaml1 A G 9: 45,430,507 H72R probably benign Het
Dyrk1b A G 7: 28,185,925 D396G probably damaging Het
Gstm2 A G 3: 107,985,241 probably null Het
Hsd3b1 A G 3: 98,853,109 Y189H probably damaging Het
Kif1c G A 11: 70,706,987 E356K probably damaging Het
Kirrel2 A C 7: 30,450,814 C17G probably damaging Het
Klhl12 A G 1: 134,475,846 H259R possibly damaging Het
Krt1 A G 15: 101,850,177 V184A probably damaging Het
Lmod2 A T 6: 24,603,595 N190Y probably benign Het
Lrp2 A C 2: 69,489,305 V1958G probably damaging Het
Ly6h T C 15: 75,565,658 S37G probably damaging Het
Man2a2 A T 7: 80,353,192 H1056Q possibly damaging Het
Mixl1 T A 1: 180,694,678 I213F probably benign Het
Morc3 T C 16: 93,853,135 I268T probably benign Het
Mtx2 C T 2: 74,876,353 T224I probably damaging Het
Olfr893 G A 9: 38,209,652 V198M possibly damaging Het
Oscp1 A C 4: 126,076,778 D120A possibly damaging Het
Parp1 G A 1: 180,588,670 V545I possibly damaging Het
Pkp2 A G 16: 16,272,218 Y790C probably damaging Het
Pomt1 T A 2: 32,252,861 probably null Het
Pp2d1 G A 17: 53,515,459 T193M probably damaging Het
Prkra G T 2: 76,630,453 H300Q probably damaging Het
Ror2 T G 13: 53,111,451 N523T probably damaging Het
Rp1 A T 1: 3,999,608 D1355E unknown Het
Rsph4a T C 10: 33,905,276 Y41H probably benign Het
Scn1a T A 2: 66,332,213 I230F probably damaging Het
Taar7e T A 10: 24,037,615 M1K probably null Het
Tex15 T G 8: 33,573,184 L1155V probably benign Het
Tmprss3 T C 17: 31,188,357 K321E probably benign Het
Tsc2 A T 17: 24,613,229 C728S probably damaging Het
Ube2e3 A T 2: 78,920,039 K203M probably damaging Het
Unc50 A T 1: 37,438,702 T222S probably damaging Het
Vmn1r236 A T 17: 21,287,616 H332L probably benign Het
Vmn2r7 G A 3: 64,691,339 T599I probably benign Het
Zfp334 A T 2: 165,381,879 D81E possibly damaging Het
Zfp710 A G 7: 80,082,040 I322V possibly damaging Het
Other mutations in Pipox
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01597:Pipox APN 11 77883193 missense probably damaging 0.99
IGL02230:Pipox APN 11 77881206 missense probably damaging 1.00
PIT4519001:Pipox UTSW 11 77883175 missense probably damaging 1.00
R0523:Pipox UTSW 11 77892139 missense probably damaging 1.00
R0666:Pipox UTSW 11 77883825 missense probably benign 0.20
R1375:Pipox UTSW 11 77881210 nonsense probably null
R1809:Pipox UTSW 11 77881534 missense probably benign 0.07
R1834:Pipox UTSW 11 77882123 missense probably damaging 1.00
R1897:Pipox UTSW 11 77882742 missense probably damaging 1.00
R2436:Pipox UTSW 11 77892117 missense probably damaging 1.00
R4674:Pipox UTSW 11 77893770 missense probably benign 0.02
R6480:Pipox UTSW 11 77882648 missense probably damaging 1.00
R6586:Pipox UTSW 11 77881179 missense possibly damaging 0.89
R6883:Pipox UTSW 11 77883903 missense probably benign 0.02
R7223:Pipox UTSW 11 77881186 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCCACCTGTCACAAGTACC -3'
(R):5'- CTGAGTAGGATAGTGGCAGCTATTC -3'

Sequencing Primer
(F):5'- ACAAGTACCCCCTCTTTTAACTG -3'
(R):5'- TGGCAGCTATTCAGTGAGGAC -3'
Posted On2018-11-06