Incidental Mutation 'R6919:Tacr1'
ID539496
Institutional Source Beutler Lab
Gene Symbol Tacr1
Ensembl Gene ENSMUSG00000030043
Gene Nametachykinin receptor 1
Synonymssubstance p receptor, Tac1r, NK1 receptor, SPr, NK1-R, neurokinin receptor 1, NK-1R
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.056) question?
Stock #R6919 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location82402334-82560104 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 82557073 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 360 (T360I)
Ref Sequence ENSEMBL: ENSMUSP00000145217 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032122] [ENSMUST00000203775]
Predicted Effect probably benign
Transcript: ENSMUST00000032122
AA Change: T360I

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000032122
Gene: ENSMUSG00000030043
AA Change: T360I

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 43 320 1.1e-8 PFAM
Pfam:7tm_1 49 305 1.5e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000203775
AA Change: T360I

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000145217
Gene: ENSMUSG00000030043
AA Change: T360I

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 43 320 1.1e-8 PFAM
Pfam:7tm_1 49 305 1.5e-58 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.8%
Validation Efficiency 99% (84/85)
MGI Phenotype FUNCTION: This gene encodes the receptor for the tachykinin, substance P, also referred to as neurokinin 1. This gene belongs to a gene family of tachykinin receptors which are characterized by interactions with G proteins and contain seven hydrophobic transmembrane regions. This receptor has been associated with nitric oxide formation, and it has been localized to cholinergic and nitrergic neurons as well as on smooth muscle cells. [provided by RefSeq, Mar 2010]
PHENOTYPE: Homozygotes for targeted null mutations exhibit reduced anxiety, pain and stress-related responses, reduced immunological response after a viral challenge, and reduced inflammatory responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700086D15Rik A G 11: 65,152,530 probably benign Het
4931408C20Rik T C 1: 26,682,934 Y1055C probably benign Het
6430548M08Rik T C 8: 120,145,482 S50P probably damaging Het
Aacs A G 5: 125,506,163 D261G probably benign Het
Abcc4 T A 14: 118,594,894 T775S probably benign Het
Acsl6 A G 11: 54,341,756 probably null Het
Agbl5 T A 5: 30,904,717 F196I probably benign Het
Ahnak2 T C 12: 112,774,684 T985A possibly damaging Het
Ak1 A T 2: 32,631,122 D101V possibly damaging Het
Alx1 A G 10: 103,025,200 Y156H probably damaging Het
Angptl7 T A 4: 148,500,031 S87C probably benign Het
Ankrd36 A G 11: 5,629,299 T188A probably benign Het
Arhgap11a A C 2: 113,839,709 S356R possibly damaging Het
Ascc3 G T 10: 50,645,753 E455* probably null Het
Atp6v0a2 G A 5: 124,712,161 probably null Het
B3gnt7 T C 1: 86,305,694 W104R probably damaging Het
Bbs9 G A 9: 22,812,544 probably null Het
Cc2d2a T A 5: 43,703,215 D544E probably benign Het
Cic C T 7: 25,271,777 T311I probably benign Het
Cngb1 T A 8: 95,248,375 R1157W probably null Het
Cntln A G 4: 85,115,368 H1310R probably benign Het
Cntnap5c A T 17: 58,293,953 I764F probably benign Het
Col26a1 T C 5: 136,744,234 Q362R possibly damaging Het
Cyp2c29 G A 19: 39,291,141 R100K probably benign Het
D17H6S53E C G 17: 35,127,246 D44E probably damaging Het
Dap3 A G 3: 88,930,989 V65A probably damaging Het
Dna2 A T 10: 62,957,003 I266F probably damaging Het
Dnah14 G A 1: 181,585,066 G57E probably benign Het
Dock9 A T 14: 121,643,152 V333E probably benign Het
Dpm1 A G 2: 168,230,275 Y27H probably damaging Het
Dsp A T 13: 38,167,655 Y150F possibly damaging Het
Emilin3 A T 2: 160,908,098 I577N probably damaging Het
Erap1 A G 13: 74,671,433 T189A probably benign Het
Fam208a T A 14: 27,449,801 L397* probably null Het
Fat2 A G 11: 55,282,771 I2372T possibly damaging Het
Fbn2 A T 18: 58,124,187 probably null Het
Gnl1 A T 17: 35,987,533 R390* probably null Het
Hivep1 A G 13: 42,183,452 I2336V probably benign Het
Il17rb C G 14: 30,004,271 probably null Het
Itga9 T C 9: 118,887,815 W396R probably damaging Het
Katnal2 A G 18: 77,011,038 V152A probably benign Het
Kcnk3 A G 5: 30,622,400 T265A probably benign Het
Klhl1 T C 14: 96,136,594 Y672C probably benign Het
Leng8 C A 7: 4,143,626 N412K possibly damaging Het
Lrrc9 T A 12: 72,506,393 F1356L probably benign Het
Map7 A G 10: 20,171,082 probably benign Het
Mei1 T C 15: 82,081,930 F251S probably damaging Het
Mia2 A G 12: 59,129,895 E9G possibly damaging Het
Ms4a13 C A 19: 11,171,885 W182C probably benign Het
Muc16 C T 9: 18,660,299 R308K unknown Het
Olfr1195 G A 2: 88,683,684 T16I possibly damaging Het
Olfr936 A G 9: 39,047,531 probably benign Het
Pcnt A G 10: 76,385,798 V1998A probably benign Het
Pgm1 A T 5: 64,097,025 N51I probably benign Het
Piezo1 T A 8: 122,490,281 H1333L probably damaging Het
Prg2 G A 2: 84,983,256 V199M probably damaging Het
Prss51 T C 14: 64,097,488 V182A probably damaging Het
Psmb9 A T 17: 34,183,225 Y132* probably null Het
Ralyl T C 3: 13,777,031 Y76H probably damaging Het
Rnaset2a A T 17: 8,130,282 D174E probably benign Het
Rnft1 G A 11: 86,495,330 probably null Het
Robo2 T C 16: 73,961,867 Y676C probably damaging Het
Samd9l T G 6: 3,376,313 Y316S possibly damaging Het
Siah3 T A 14: 75,456,138 F28Y possibly damaging Het
Slc28a3 C T 13: 58,573,443 probably null Het
Slc8a1 A G 17: 81,388,872 F911S probably damaging Het
Speg T A 1: 75,387,908 L156* probably null Het
Spopl T G 2: 23,517,861 M269L probably benign Het
Tmem262 A G 19: 6,080,737 E95G probably benign Het
Tmem68 G T 4: 3,569,669 T7N possibly damaging Het
Top3a T A 11: 60,749,493 I460F probably damaging Het
Trafd1 G A 5: 121,384,074 R5* probably null Het
Trim16 T A 11: 62,840,869 V435D possibly damaging Het
Tspan17 A G 13: 54,796,033 D236G probably damaging Het
Tssk2 A T 16: 17,899,701 M323L probably benign Het
Ubqln5 A G 7: 104,129,008 V203A probably benign Het
Utrn A T 10: 12,693,470 L1134* probably null Het
Vmn1r37 C T 6: 66,731,720 S73F possibly damaging Het
Vps13c A G 9: 67,927,452 K1688E probably damaging Het
Zbtb39 A G 10: 127,741,842 D95G probably damaging Het
Zfhx3 T A 8: 108,800,528 I1019N probably damaging Het
Zfp207 C T 11: 80,395,503 probably benign Het
Zmiz1 C T 14: 25,643,638 T169M probably damaging Het
Other mutations in Tacr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01377:Tacr1 APN 6 82403655 missense probably benign 0.01
IGL01875:Tacr1 APN 6 82557016 missense probably benign 0.18
IGL02092:Tacr1 APN 6 82403919 missense probably damaging 1.00
IGL02506:Tacr1 APN 6 82403758 missense probably damaging 1.00
IGL02651:Tacr1 APN 6 82492641 missense probably damaging 0.98
R0627:Tacr1 UTSW 6 82555031 missense possibly damaging 0.93
R0732:Tacr1 UTSW 6 82552901 missense probably damaging 1.00
R1279:Tacr1 UTSW 6 82557183 nonsense probably null
R1292:Tacr1 UTSW 6 82554875 missense probably damaging 0.98
R1480:Tacr1 UTSW 6 82492530 missense possibly damaging 0.47
R1595:Tacr1 UTSW 6 82403742 missense probably benign 0.05
R2061:Tacr1 UTSW 6 82492554 missense probably damaging 0.96
R2260:Tacr1 UTSW 6 82403775 missense probably damaging 1.00
R2697:Tacr1 UTSW 6 82492597 missense probably damaging 1.00
R2941:Tacr1 UTSW 6 82403734 missense probably damaging 1.00
R4629:Tacr1 UTSW 6 82403880 missense probably benign 0.02
R4780:Tacr1 UTSW 6 82557072 missense probably benign
R4916:Tacr1 UTSW 6 82554941 missense probably benign 0.00
R5065:Tacr1 UTSW 6 82554878 missense possibly damaging 0.94
R5801:Tacr1 UTSW 6 82557153 missense probably benign 0.04
R6941:Tacr1 UTSW 6 82403865 missense possibly damaging 0.75
R7269:Tacr1 UTSW 6 82492711 missense probably benign
Z1177:Tacr1 UTSW 6 82554997 missense not run
Predicted Primers PCR Primer
(F):5'- ATCCCACGTTGAGGAACTG -3'
(R):5'- GTGCCCTGGAAATGTGTCTG -3'

Sequencing Primer
(F):5'- TTCTTAGAAGGCAATCCCAGG -3'
(R):5'- AAATGTGTCTGCTGCTTAGGCC -3'
Posted On2018-11-06