Mutagenetix > Incidental Mutations

Incidental Mutation 'R6919:Muc16'

539504

Institutional Source

Beutler Lab

Gene Symbol

Muc16

Ensembl Gene

ENSMUSG00000109564

Gene Name

mucin 16

Synonyms

1110008I14Rik, LOC385009

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.200) question?

Stock #

R6919 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

18495455-18674530 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 18660299 bp

Zygosity

Heterozygous

Amino Acid Change

Arginine to Lysine at position 308 (R308K)

Ref Sequence

ENSEMBL: ENSMUSP00000147104 (fasta)

Predicted Effect

unknown
Transcript: ENSMUST00000208663
AA Change: R308K

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.3%
20x: 97.8%

Validation Efficiency

99% (84/85)

MGI Phenotype

PHENOTYPE: Homozygous null mice are viable and fertile with no gross histological abnormalities. Homozygous male mice father larger litters when crossed to wild-type females. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 83 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700086D15Rik	A	G	11: 65,152,530		probably benign	Het
4931408C20Rik	T	C	1: 26,682,934	Y1055C	probably benign	Het
6430548M08Rik	T	C	8: 120,145,482	S50P	probably damaging	Het
Aacs	A	G	5: 125,506,163	D261G	probably benign	Het
Abcc4	T	A	14: 118,594,894	T775S	probably benign	Het
Acsl6	A	G	11: 54,341,756		probably null	Het
Agbl5	T	A	5: 30,904,717	F196I	probably benign	Het
Ahnak2	T	C	12: 112,774,684	T985A	possibly damaging	Het
Ak1	A	T	2: 32,631,122	D101V	possibly damaging	Het
Alx1	A	G	10: 103,025,200	Y156H	probably damaging	Het
Angptl7	T	A	4: 148,500,031	S87C	probably benign	Het
Ankrd36	A	G	11: 5,629,299	T188A	probably benign	Het
Arhgap11a	A	C	2: 113,839,709	S356R	possibly damaging	Het
Ascc3	G	T	10: 50,645,753	E455*	probably null	Het
Atp6v0a2	G	A	5: 124,712,161		probably null	Het
B3gnt7	T	C	1: 86,305,694	W104R	probably damaging	Het
Bbs9	G	A	9: 22,812,544		probably null	Het
Cc2d2a	T	A	5: 43,703,215	D544E	probably benign	Het
Cic	C	T	7: 25,271,777	T311I	probably benign	Het
Cngb1	T	A	8: 95,248,375	R1157W	probably null	Het
Cntln	A	G	4: 85,115,368	H1310R	probably benign	Het
Cntnap5c	A	T	17: 58,293,953	I764F	probably benign	Het
Col26a1	T	C	5: 136,744,234	Q362R	possibly damaging	Het
Cyp2c29	G	A	19: 39,291,141	R100K	probably benign	Het
D17H6S53E	C	G	17: 35,127,246	D44E	probably damaging	Het
Dap3	A	G	3: 88,930,989	V65A	probably damaging	Het
Dna2	A	T	10: 62,957,003	I266F	probably damaging	Het
Dnah14	G	A	1: 181,585,066	G57E	probably benign	Het
Dock9	A	T	14: 121,643,152	V333E	probably benign	Het
Dpm1	A	G	2: 168,230,275	Y27H	probably damaging	Het
Dsp	A	T	13: 38,167,655	Y150F	possibly damaging	Het
Emilin3	A	T	2: 160,908,098	I577N	probably damaging	Het
Erap1	A	G	13: 74,671,433	T189A	probably benign	Het
Fam208a	T	A	14: 27,449,801	L397*	probably null	Het
Fat2	A	G	11: 55,282,771	I2372T	possibly damaging	Het
Fbn2	A	T	18: 58,124,187		probably null	Het
Gnl1	A	T	17: 35,987,533	R390*	probably null	Het
Hivep1	A	G	13: 42,183,452	I2336V	probably benign	Het
Il17rb	C	G	14: 30,004,271		probably null	Het
Itga9	T	C	9: 118,887,815	W396R	probably damaging	Het
Katnal2	A	G	18: 77,011,038	V152A	probably benign	Het
Kcnk3	A	G	5: 30,622,400	T265A	probably benign	Het
Klhl1	T	C	14: 96,136,594	Y672C	probably benign	Het
Leng8	C	A	7: 4,143,626	N412K	possibly damaging	Het
Lrrc9	T	A	12: 72,506,393	F1356L	probably benign	Het
Map7	A	G	10: 20,171,082		probably benign	Het
Mei1	T	C	15: 82,081,930	F251S	probably damaging	Het
Mia2	A	G	12: 59,129,895	E9G	possibly damaging	Het
Ms4a13	C	A	19: 11,171,885	W182C	probably benign	Het
Olfr1195	G	A	2: 88,683,684	T16I	possibly damaging	Het
Olfr936	A	G	9: 39,047,531		probably benign	Het
Pcnt	A	G	10: 76,385,798	V1998A	probably benign	Het
Pgm1	A	T	5: 64,097,025	N51I	probably benign	Het
Piezo1	T	A	8: 122,490,281	H1333L	probably damaging	Het
Prg2	G	A	2: 84,983,256	V199M	probably damaging	Het
Prss51	T	C	14: 64,097,488	V182A	probably damaging	Het
Psmb9	A	T	17: 34,183,225	Y132*	probably null	Het
Ralyl	T	C	3: 13,777,031	Y76H	probably damaging	Het
Rnaset2a	A	T	17: 8,130,282	D174E	probably benign	Het
Rnft1	G	A	11: 86,495,330		probably null	Het
Robo2	T	C	16: 73,961,867	Y676C	probably damaging	Het
Samd9l	T	G	6: 3,376,313	Y316S	possibly damaging	Het
Siah3	T	A	14: 75,456,138	F28Y	possibly damaging	Het
Slc28a3	C	T	13: 58,573,443		probably null	Het
Slc8a1	A	G	17: 81,388,872	F911S	probably damaging	Het
Speg	T	A	1: 75,387,908	L156*	probably null	Het
Spopl	T	G	2: 23,517,861	M269L	probably benign	Het
Tacr1	C	T	6: 82,557,073	T360I	probably benign	Het
Tmem262	A	G	19: 6,080,737	E95G	probably benign	Het
Tmem68	G	T	4: 3,569,669	T7N	possibly damaging	Het
Top3a	T	A	11: 60,749,493	I460F	probably damaging	Het
Trafd1	G	A	5: 121,384,074	R5*	probably null	Het
Trim16	T	A	11: 62,840,869	V435D	possibly damaging	Het
Tspan17	A	G	13: 54,796,033	D236G	probably damaging	Het
Tssk2	A	T	16: 17,899,701	M323L	probably benign	Het
Ubqln5	A	G	7: 104,129,008	V203A	probably benign	Het
Utrn	A	T	10: 12,693,470	L1134*	probably null	Het
Vmn1r37	C	T	6: 66,731,720	S73F	possibly damaging	Het
Vps13c	A	G	9: 67,927,452	K1688E	probably damaging	Het
Zbtb39	A	G	10: 127,741,842	D95G	probably damaging	Het
Zfhx3	T	A	8: 108,800,528	I1019N	probably damaging	Het
Zfp207	C	T	11: 80,395,503		probably benign	Het
Zmiz1	C	T	14: 25,643,638	T169M	probably damaging	Het

Other mutations in Muc16

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01330:Muc16	APN	9	18508507	missense	possibly damaging	0.89
IGL01878:Muc16	APN	9	18495543	missense	possibly damaging	0.90
IGL02394:Muc16	APN	9	18498700	missense	probably damaging	0.99
IGL02553:Muc16	APN	9	18498553	critical splice donor site	probably null
R0400:Muc16	UTSW	9	18510534	missense	possibly damaging	0.74
R1620:Muc16	UTSW	9	18510477	missense	possibly damaging	0.89
R1695:Muc16	UTSW	9	18497433	missense	probably damaging	1.00
R3196:Muc16	UTSW	9	18497830	missense	probably damaging	1.00
R5982:Muc16	UTSW	9	18647146	missense	unknown
R5990:Muc16	UTSW	9	18659243	missense	unknown
R6024:Muc16	UTSW	9	18646671	missense	unknown
R6026:Muc16	UTSW	9	18659858	missense	unknown
R6028:Muc16	UTSW	9	18657176	missense	unknown
R6083:Muc16	UTSW	9	18657212	missense	unknown
R6089:Muc16	UTSW	9	18643252	missense	unknown
R6109:Muc16	UTSW	9	18655359	missense	unknown
R6127:Muc16	UTSW	9	18657878	missense	unknown
R6130:Muc16	UTSW	9	18590698	missense	probably damaging	1.00
R6146:Muc16	UTSW	9	18497797	missense	probably damaging	0.98
R6161:Muc16	UTSW	9	18647818	missense	unknown
R6164:Muc16	UTSW	9	18558379	missense	probably damaging	1.00
R6185:Muc16	UTSW	9	18654473	missense	unknown
R6192:Muc16	UTSW	9	18658689	missense	unknown
R6217:Muc16	UTSW	9	18655446	missense	unknown
R6232:Muc16	UTSW	9	18656998	missense	unknown
R6246:Muc16	UTSW	9	18577067	intron	probably null
R6255:Muc16	UTSW	9	18655599	missense	unknown
R6280:Muc16	UTSW	9	18579317	critical splice donor site	probably null
R6286:Muc16	UTSW	9	18644389	missense	unknown
R6287:Muc16	UTSW	9	18659034	missense	unknown
R6307:Muc16	UTSW	9	18647588	missense	unknown
R6310:Muc16	UTSW	9	18641950	missense	probably benign	0.00
R6316:Muc16	UTSW	9	18641819	missense	probably benign	0.01
R6335:Muc16	UTSW	9	18660708	missense	unknown
R6345:Muc16	UTSW	9	18654926	missense	unknown
R6349:Muc16	UTSW	9	18657329	missense	unknown
R6366:Muc16	UTSW	9	18646044	missense	unknown
R6393:Muc16	UTSW	9	18647399	nonsense	probably null
R6440:Muc16	UTSW	9	18641359	missense	probably benign	0.01
R6458:Muc16	UTSW	9	18641721	missense	probably benign	0.01
R6460:Muc16	UTSW	9	18640516	missense	probably benign	0.01
R6481:Muc16	UTSW	9	18550677	critical splice donor site	probably null
R6539:Muc16	UTSW	9	18637325	missense	probably benign	0.25
R6551:Muc16	UTSW	9	18562562	missense	possibly damaging	0.95
R6596:Muc16	UTSW	9	18566715	missense	probably benign	0.18
R6601:Muc16	UTSW	9	18637570	missense	probably benign	0.10
R6602:Muc16	UTSW	9	18609476	intron	probably null
R6615:Muc16	UTSW	9	18647188	missense	unknown
R6625:Muc16	UTSW	9	18660278	missense	unknown
R6668:Muc16	UTSW	9	18640385	missense	probably benign	0.03
R6697:Muc16	UTSW	9	18641291	missense	probably benign	0.01
R6710:Muc16	UTSW	9	18642070	missense	possibly damaging	0.95
R6727:Muc16	UTSW	9	18566690	critical splice donor site	probably null
R6789:Muc16	UTSW	9	18559986	missense	probably benign	0.40
R6806:Muc16	UTSW	9	18537910	critical splice donor site	probably null
R6874:Muc16	UTSW	9	18658769	nonsense	probably null
R6894:Muc16	UTSW	9	18495576	missense	possibly damaging	0.92
R6913:Muc16	UTSW	9	18642663	missense	unknown
R6939:Muc16	UTSW	9	18638537	missense	probably benign	0.04
R6953:Muc16	UTSW	9	18640529	missense	probably benign	0.01
R6956:Muc16	UTSW	9	18645026	missense	unknown
R6977:Muc16	UTSW	9	18645337	missense	unknown
R6996:Muc16	UTSW	9	18645897	missense	unknown
R7011:Muc16	UTSW	9	18637451	missense	probably benign	0.26
R7011:Muc16	UTSW	9	18637543	missense	probably benign	0.10
R7012:Muc16	UTSW	9	18495618	critical splice acceptor site	probably null
R7014:Muc16	UTSW	9	18658236	missense	unknown
R7021:Muc16	UTSW	9	18554919	missense	unknown
R7021:Muc16	UTSW	9	18550831	splice site	probably null
R7038:Muc16	UTSW	9	18620468	missense	probably damaging	0.99
R7057:Muc16	UTSW	9	18646079	missense	unknown
R7058:Muc16	UTSW	9	18639755	missense	probably benign	0.10
R7066:Muc16	UTSW	9	18658021	missense	unknown
R7067:Muc16	UTSW	9	18658251	missense	unknown
R7070:Muc16	UTSW	9	18645923	nonsense	probably null
R7074:Muc16	UTSW	9	18655650	missense	unknown
R7085:Muc16	UTSW	9	18644849	missense	unknown
R7088:Muc16	UTSW	9	18592680	missense	probably damaging	0.99
R7107:Muc16	UTSW	9	18637298	missense	probably benign	0.10
R7108:Muc16	UTSW	9	18655233	missense	unknown
R7126:Muc16	UTSW	9	18641216	missense	probably benign	0.01
R7128:Muc16	UTSW	9	18643004	missense	unknown
R7145:Muc16	UTSW	9	18655580	missense	unknown
R7179:Muc16	UTSW	9	18642008	missense	probably benign	0.00
R7194:Muc16	UTSW	9	18674454	missense	unknown
R7211:Muc16	UTSW	9	18498570	missense	probably damaging	1.00
R7213:Muc16	UTSW	9	18641416	missense	probably benign	0.01
R7217:Muc16	UTSW	9	18644076	nonsense	probably null
R7221:Muc16	UTSW	9	18642199	missense	probably benign	0.04
R7265:Muc16	UTSW	9	18656472	missense	unknown
R7326:Muc16	UTSW	9	18585013	missense	probably benign	0.03
R7359:Muc16	UTSW	9	18643020	missense	unknown
R7387:Muc16	UTSW	9	18641720	missense	probably benign	0.01
R7391:Muc16	UTSW	9	18639536	missense	probably benign	0.04
R7398:Muc16	UTSW	9	18637742	missense	possibly damaging	0.46
R7419:Muc16	UTSW	9	18641962	missense	probably benign	0.01
R7431:Muc16	UTSW	9	18607993	missense
R7484:Muc16	UTSW	9	18646768	missense	unknown
R7487:Muc16	UTSW	9	18584799	missense	possibly damaging	0.93
R7497:Muc16	UTSW	9	18645089	missense	unknown
R7515:Muc16	UTSW	9	18639662	missense	probably benign	0.00
R7537:Muc16	UTSW	9	18638135	missense	probably benign	0.06
R7538:Muc16	UTSW	9	18642131	missense	probably benign	0.10
R7538:Muc16	UTSW	9	18655451	missense	unknown
R7543:Muc16	UTSW	9	18644732	missense	unknown
R7566:Muc16	UTSW	9	18638629	missense	probably benign	0.00
R7581:Muc16	UTSW	9	18645614	missense	unknown
R7594:Muc16	UTSW	9	18645062	missense	unknown
R7629:Muc16	UTSW	9	18566785	missense	possibly damaging	0.86
R7664:Muc16	UTSW	9	18607722	missense	probably benign	0.08
R7666:Muc16	UTSW	9	18558427	missense	probably damaging	1.00
R7703:Muc16	UTSW	9	18605282	missense
R7727:Muc16	UTSW	9	18660242	missense	unknown

Predicted Primers

PCR Primer
(F):5'- GAAAGATTCATGGGCACTTCAG -3'
(R):5'- AATCTCCACTGGAATGCCC -3'

Sequencing Primer
(F):5'- AAGATTCATGGGCACTTCAGTATGG -3'
(R):5'- CAGATAGAACATTTTGTGGTAACCCC -3'

Posted On

2018-11-06