Incidental Mutation 'R6919:Muc16'
ID539504
Institutional Source Beutler Lab
Gene Symbol Muc16
Ensembl Gene ENSMUSG00000109564
Gene Namemucin 16
Synonyms1110008I14Rik, LOC385009
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.140) question?
Stock #R6919 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location18495455-18674530 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 18660299 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Lysine at position 308 (R308K)
Ref Sequence ENSEMBL: ENSMUSP00000147104 (fasta)
Predicted Effect unknown
Transcript: ENSMUST00000208663
AA Change: R308K
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.8%
Validation Efficiency 99% (84/85)
MGI Phenotype PHENOTYPE: Homozygous null mice are viable and fertile with no gross histological abnormalities. Homozygous male mice father larger litters when crossed to wild-type females. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700086D15Rik A G 11: 65,152,530 probably benign Het
4931408C20Rik T C 1: 26,682,934 Y1055C probably benign Het
6430548M08Rik T C 8: 120,145,482 S50P probably damaging Het
Aacs A G 5: 125,506,163 D261G probably benign Het
Abcc4 T A 14: 118,594,894 T775S probably benign Het
Acsl6 A G 11: 54,341,756 probably null Het
Agbl5 T A 5: 30,904,717 F196I probably benign Het
Ahnak2 T C 12: 112,774,684 T985A possibly damaging Het
Ak1 A T 2: 32,631,122 D101V possibly damaging Het
Alx1 A G 10: 103,025,200 Y156H probably damaging Het
Angptl7 T A 4: 148,500,031 S87C probably benign Het
Ankrd36 A G 11: 5,629,299 T188A probably benign Het
Arhgap11a A C 2: 113,839,709 S356R possibly damaging Het
Ascc3 G T 10: 50,645,753 E455* probably null Het
Atp6v0a2 G A 5: 124,712,161 probably null Het
B3gnt7 T C 1: 86,305,694 W104R probably damaging Het
Bbs9 G A 9: 22,812,544 probably null Het
Cc2d2a T A 5: 43,703,215 D544E probably benign Het
Cic C T 7: 25,271,777 T311I probably benign Het
Cngb1 T A 8: 95,248,375 R1157W probably null Het
Cntln A G 4: 85,115,368 H1310R probably benign Het
Cntnap5c A T 17: 58,293,953 I764F probably benign Het
Col26a1 T C 5: 136,744,234 Q362R possibly damaging Het
Cyp2c29 G A 19: 39,291,141 R100K probably benign Het
D17H6S53E C G 17: 35,127,246 D44E probably damaging Het
Dap3 A G 3: 88,930,989 V65A probably damaging Het
Dna2 A T 10: 62,957,003 I266F probably damaging Het
Dnah14 G A 1: 181,585,066 G57E probably benign Het
Dock9 A T 14: 121,643,152 V333E probably benign Het
Dpm1 A G 2: 168,230,275 Y27H probably damaging Het
Dsp A T 13: 38,167,655 Y150F possibly damaging Het
Emilin3 A T 2: 160,908,098 I577N probably damaging Het
Erap1 A G 13: 74,671,433 T189A probably benign Het
Fam208a T A 14: 27,449,801 L397* probably null Het
Fat2 A G 11: 55,282,771 I2372T possibly damaging Het
Fbn2 A T 18: 58,124,187 probably null Het
Gnl1 A T 17: 35,987,533 R390* probably null Het
Hivep1 A G 13: 42,183,452 I2336V probably benign Het
Il17rb C G 14: 30,004,271 probably null Het
Itga9 T C 9: 118,887,815 W396R probably damaging Het
Katnal2 A G 18: 77,011,038 V152A probably benign Het
Kcnk3 A G 5: 30,622,400 T265A probably benign Het
Klhl1 T C 14: 96,136,594 Y672C probably benign Het
Leng8 C A 7: 4,143,626 N412K possibly damaging Het
Lrrc9 T A 12: 72,506,393 F1356L probably benign Het
Map7 A G 10: 20,171,082 probably benign Het
Mei1 T C 15: 82,081,930 F251S probably damaging Het
Mia2 A G 12: 59,129,895 E9G possibly damaging Het
Ms4a13 C A 19: 11,171,885 W182C probably benign Het
Olfr1195 G A 2: 88,683,684 T16I possibly damaging Het
Olfr936 A G 9: 39,047,531 probably benign Het
Pcnt A G 10: 76,385,798 V1998A probably benign Het
Pgm1 A T 5: 64,097,025 N51I probably benign Het
Piezo1 T A 8: 122,490,281 H1333L probably damaging Het
Prg2 G A 2: 84,983,256 V199M probably damaging Het
Prss51 T C 14: 64,097,488 V182A probably damaging Het
Psmb9 A T 17: 34,183,225 Y132* probably null Het
Ralyl T C 3: 13,777,031 Y76H probably damaging Het
Rnaset2a A T 17: 8,130,282 D174E probably benign Het
Rnft1 G A 11: 86,495,330 probably null Het
Robo2 T C 16: 73,961,867 Y676C probably damaging Het
Samd9l T G 6: 3,376,313 Y316S possibly damaging Het
Siah3 T A 14: 75,456,138 F28Y possibly damaging Het
Slc28a3 C T 13: 58,573,443 probably null Het
Slc8a1 A G 17: 81,388,872 F911S probably damaging Het
Speg T A 1: 75,387,908 L156* probably null Het
Spopl T G 2: 23,517,861 M269L probably benign Het
Tacr1 C T 6: 82,557,073 T360I probably benign Het
Tmem262 A G 19: 6,080,737 E95G probably benign Het
Tmem68 G T 4: 3,569,669 T7N possibly damaging Het
Top3a T A 11: 60,749,493 I460F probably damaging Het
Trafd1 G A 5: 121,384,074 R5* probably null Het
Trim16 T A 11: 62,840,869 V435D possibly damaging Het
Tspan17 A G 13: 54,796,033 D236G probably damaging Het
Tssk2 A T 16: 17,899,701 M323L probably benign Het
Ubqln5 A G 7: 104,129,008 V203A probably benign Het
Utrn A T 10: 12,693,470 L1134* probably null Het
Vmn1r37 C T 6: 66,731,720 S73F possibly damaging Het
Vps13c A G 9: 67,927,452 K1688E probably damaging Het
Zbtb39 A G 10: 127,741,842 D95G probably damaging Het
Zfhx3 T A 8: 108,800,528 I1019N probably damaging Het
Zfp207 C T 11: 80,395,503 probably benign Het
Zmiz1 C T 14: 25,643,638 T169M probably damaging Het
Other mutations in Muc16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01330:Muc16 APN 9 18508507 missense possibly damaging 0.89
IGL01878:Muc16 APN 9 18495543 missense possibly damaging 0.90
IGL02394:Muc16 APN 9 18498700 missense probably damaging 0.99
IGL02553:Muc16 APN 9 18498553 critical splice donor site probably null
R0400:Muc16 UTSW 9 18510534 missense possibly damaging 0.74
R1620:Muc16 UTSW 9 18510477 missense possibly damaging 0.89
R1695:Muc16 UTSW 9 18497433 missense probably damaging 1.00
R3196:Muc16 UTSW 9 18497830 missense probably damaging 1.00
R5982:Muc16 UTSW 9 18647146 missense unknown
R5990:Muc16 UTSW 9 18659243 missense unknown
R6024:Muc16 UTSW 9 18646671 missense unknown
R6026:Muc16 UTSW 9 18659858 missense unknown
R6028:Muc16 UTSW 9 18657176 missense unknown
R6083:Muc16 UTSW 9 18657212 missense unknown
R6089:Muc16 UTSW 9 18643252 missense unknown
R6109:Muc16 UTSW 9 18655359 missense unknown
R6127:Muc16 UTSW 9 18657878 missense unknown
R6130:Muc16 UTSW 9 18590698 missense probably damaging 1.00
R6146:Muc16 UTSW 9 18497797 missense probably damaging 0.98
R6161:Muc16 UTSW 9 18647818 missense unknown
R6164:Muc16 UTSW 9 18558379 missense probably damaging 1.00
R6185:Muc16 UTSW 9 18654473 missense unknown
R6192:Muc16 UTSW 9 18658689 missense unknown
R6217:Muc16 UTSW 9 18655446 missense unknown
R6232:Muc16 UTSW 9 18656998 missense unknown
R6246:Muc16 UTSW 9 18577067 splice site probably null
R6255:Muc16 UTSW 9 18655599 missense unknown
R6280:Muc16 UTSW 9 18579317 critical splice donor site probably null
R6286:Muc16 UTSW 9 18644389 missense unknown
R6287:Muc16 UTSW 9 18659034 missense unknown
R6307:Muc16 UTSW 9 18647588 missense unknown
R6310:Muc16 UTSW 9 18641950 missense probably benign 0.00
R6316:Muc16 UTSW 9 18641819 missense probably benign 0.01
R6335:Muc16 UTSW 9 18660708 missense unknown
R6345:Muc16 UTSW 9 18654926 missense unknown
R6349:Muc16 UTSW 9 18657329 missense unknown
R6366:Muc16 UTSW 9 18646044 missense unknown
R6393:Muc16 UTSW 9 18647399 nonsense probably null
R6440:Muc16 UTSW 9 18641359 missense probably benign 0.01
R6458:Muc16 UTSW 9 18641721 missense probably benign 0.01
R6460:Muc16 UTSW 9 18640516 missense probably benign 0.01
R6481:Muc16 UTSW 9 18550677 critical splice donor site probably null
R6539:Muc16 UTSW 9 18637325 missense probably benign 0.25
R6551:Muc16 UTSW 9 18562562 missense possibly damaging 0.95
R6596:Muc16 UTSW 9 18566715 missense probably benign 0.18
R6601:Muc16 UTSW 9 18637570 missense probably benign 0.10
R6602:Muc16 UTSW 9 18609476 splice site probably null
R6615:Muc16 UTSW 9 18647188 missense unknown
R6625:Muc16 UTSW 9 18660278 missense unknown
R6668:Muc16 UTSW 9 18640385 missense probably benign 0.03
R6697:Muc16 UTSW 9 18641291 missense probably benign 0.01
R6710:Muc16 UTSW 9 18642070 missense possibly damaging 0.95
R6727:Muc16 UTSW 9 18566690 critical splice donor site probably null
R6789:Muc16 UTSW 9 18559986 missense probably benign 0.40
R6806:Muc16 UTSW 9 18537910 critical splice donor site probably null
R6874:Muc16 UTSW 9 18658769 nonsense probably null
R6894:Muc16 UTSW 9 18495576 missense possibly damaging 0.92
R6913:Muc16 UTSW 9 18642663 missense unknown
R6939:Muc16 UTSW 9 18638537 missense probably benign 0.04
R6953:Muc16 UTSW 9 18640529 missense probably benign 0.01
R6956:Muc16 UTSW 9 18645026 missense unknown
R6977:Muc16 UTSW 9 18645337 missense unknown
R6996:Muc16 UTSW 9 18645897 missense unknown
R7011:Muc16 UTSW 9 18637451 missense probably benign 0.26
R7011:Muc16 UTSW 9 18637543 missense probably benign 0.10
R7012:Muc16 UTSW 9 18495618 critical splice acceptor site probably null
R7014:Muc16 UTSW 9 18658236 missense unknown
R7021:Muc16 UTSW 9 18554919 missense unknown
R7021:Muc16 UTSW 9 18550831 splice site probably null
R7038:Muc16 UTSW 9 18620468 missense probably damaging 0.99
R7057:Muc16 UTSW 9 18646079 missense unknown
R7058:Muc16 UTSW 9 18639755 missense probably benign 0.10
R7066:Muc16 UTSW 9 18658021 missense unknown
R7067:Muc16 UTSW 9 18658251 missense unknown
R7070:Muc16 UTSW 9 18645923 nonsense probably null
R7074:Muc16 UTSW 9 18655650 missense unknown
R7085:Muc16 UTSW 9 18644849 missense unknown
R7088:Muc16 UTSW 9 18592680 missense probably damaging 0.99
R7107:Muc16 UTSW 9 18637298 missense probably benign 0.10
R7108:Muc16 UTSW 9 18655233 missense unknown
R7126:Muc16 UTSW 9 18641216 missense probably benign 0.01
R7128:Muc16 UTSW 9 18643004 missense unknown
R7145:Muc16 UTSW 9 18655580 missense unknown
R7179:Muc16 UTSW 9 18642008 missense probably benign 0.00
R7194:Muc16 UTSW 9 18674454 missense unknown
R7211:Muc16 UTSW 9 18498570 missense probably damaging 1.00
R7213:Muc16 UTSW 9 18641416 missense probably benign 0.01
R7217:Muc16 UTSW 9 18644076 nonsense probably null
R7221:Muc16 UTSW 9 18642199 missense probably benign 0.04
R7265:Muc16 UTSW 9 18656472 missense unknown
R7326:Muc16 UTSW 9 18585013 missense probably benign 0.03
R7359:Muc16 UTSW 9 18643020 missense unknown
R7387:Muc16 UTSW 9 18641720 missense probably benign 0.01
R7391:Muc16 UTSW 9 18639536 missense probably benign 0.04
R7398:Muc16 UTSW 9 18637742 missense possibly damaging 0.46
R7419:Muc16 UTSW 9 18641962 missense probably benign 0.01
R7431:Muc16 UTSW 9 18607993 missense
R7484:Muc16 UTSW 9 18646768 missense unknown
R7487:Muc16 UTSW 9 18584799 missense possibly damaging 0.93
R7497:Muc16 UTSW 9 18645089 missense unknown
R7515:Muc16 UTSW 9 18639662 missense probably benign 0.00
R7537:Muc16 UTSW 9 18638135 missense probably benign 0.06
R7538:Muc16 UTSW 9 18642131 missense probably benign 0.10
R7538:Muc16 UTSW 9 18655451 missense unknown
R7543:Muc16 UTSW 9 18644732 missense unknown
R7566:Muc16 UTSW 9 18638629 missense probably benign 0.00
R7581:Muc16 UTSW 9 18645614 missense unknown
R7594:Muc16 UTSW 9 18645062 missense unknown
R7629:Muc16 UTSW 9 18566785 missense possibly damaging 0.86
R7664:Muc16 UTSW 9 18607722 missense probably benign 0.08
R7666:Muc16 UTSW 9 18558427 missense probably damaging 1.00
R7703:Muc16 UTSW 9 18605282 missense
R7727:Muc16 UTSW 9 18660242 missense unknown
R7743:Muc16 UTSW 9 18657477 missense unknown
R7744:Muc16 UTSW 9 18585096 critical splice acceptor site probably null
R7761:Muc16 UTSW 9 18580574 missense probably damaging 1.00
R7769:Muc16 UTSW 9 18660507 missense unknown
R7805:Muc16 UTSW 9 18638493 missense possibly damaging 0.94
R7827:Muc16 UTSW 9 18595223 missense possibly damaging 0.83
R7845:Muc16 UTSW 9 18640773 missense probably benign 0.01
R7849:Muc16 UTSW 9 18640505 missense probably benign 0.01
R7884:Muc16 UTSW 9 18642694 missense unknown
R7885:Muc16 UTSW 9 18639464 missense probably benign 0.10
R7886:Muc16 UTSW 9 18585982 missense probably benign 0.03
R7899:Muc16 UTSW 9 18640697 missense probably benign 0.01
R7904:Muc16 UTSW 9 18655650 missense unknown
R7921:Muc16 UTSW 9 18659318 missense unknown
R7922:Muc16 UTSW 9 18584825 missense probably benign 0.16
R7948:Muc16 UTSW 9 18642490 missense unknown
R7957:Muc16 UTSW 9 18643471 missense unknown
R7972:Muc16 UTSW 9 18645764 nonsense probably null
R7992:Muc16 UTSW 9 18656429 missense unknown
R7998:Muc16 UTSW 9 18639892 missense probably benign 0.04
R8014:Muc16 UTSW 9 18654875 missense unknown
R8033:Muc16 UTSW 9 18636606 missense probably benign 0.26
R8052:Muc16 UTSW 9 18659051 missense unknown
R8058:Muc16 UTSW 9 18660002 nonsense probably null
R8088:Muc16 UTSW 9 18519300 nonsense probably null
R8095:Muc16 UTSW 9 18584830 nonsense probably null
R8111:Muc16 UTSW 9 18592629 missense possibly damaging 0.55
R8116:Muc16 UTSW 9 18658737 missense unknown
R8117:Muc16 UTSW 9 18508910 nonsense probably null
R8137:Muc16 UTSW 9 18645676 missense unknown
R8196:Muc16 UTSW 9 18645334 missense unknown
R8218:Muc16 UTSW 9 18637019 missense possibly damaging 0.48
R8285:Muc16 UTSW 9 18642977 missense unknown
R8313:Muc16 UTSW 9 18525147 missense possibly damaging 0.85
R8317:Muc16 UTSW 9 18658043 missense unknown
R8342:Muc16 UTSW 9 18658685 missense unknown
R8351:Muc16 UTSW 9 18659885 missense unknown
R8356:Muc16 UTSW 9 18658778 missense unknown
R8360:Muc16 UTSW 9 18525258 missense probably benign 0.01
R8418:Muc16 UTSW 9 18519630 missense possibly damaging 0.94
R8420:Muc16 UTSW 9 18537511 missense probably damaging 0.99
R8437:Muc16 UTSW 9 18657924 missense unknown
R8463:Muc16 UTSW 9 18659139 missense unknown
R8466:Muc16 UTSW 9 18643148 missense unknown
R8512:Muc16 UTSW 9 18638192 missense probably benign 0.01
R8518:Muc16 UTSW 9 18519631 missense probably benign 0.12
R8556:Muc16 UTSW 9 18640937 missense probably benign 0.01
Z1177:Muc16 UTSW 9 18537571 missense probably benign 0.26
Z1177:Muc16 UTSW 9 18657861 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GAAAGATTCATGGGCACTTCAG -3'
(R):5'- AATCTCCACTGGAATGCCC -3'

Sequencing Primer
(F):5'- AAGATTCATGGGCACTTCAGTATGG -3'
(R):5'- CAGATAGAACATTTTGTGGTAACCCC -3'
Posted On2018-11-06