Incidental Mutation 'R6919:Utrn'
ID539508
Institutional Source Beutler Lab
Gene Symbol Utrn
Ensembl Gene ENSMUSG00000019820
Gene Nameutrophin
SynonymsG-utrophin, DRP, Dmdl
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6919 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location12382188-12869365 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 12693470 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Stop codon at position 1134 (L1134*)
Ref Sequence ENSEMBL: ENSMUSP00000151431 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076817] [ENSMUST00000218635]
Predicted Effect probably null
Transcript: ENSMUST00000076817
AA Change: L1134*
SMART Domains Protein: ENSMUSP00000076093
Gene: ENSMUSG00000019820
AA Change: L1134*

DomainStartEndE-ValueType
CH 33 133 1.87e-24 SMART
CH 152 250 4.05e-20 SMART
SPEC 312 416 2.31e-18 SMART
SPEC 421 525 4.18e-16 SMART
SPEC 532 636 3.35e-6 SMART
low complexity region 665 679 N/A INTRINSIC
SPEC 690 795 1.7e-7 SMART
SPEC 801 901 1e-4 SMART
SPEC 910 1012 8.24e-2 SMART
SPEC 1019 1121 1.32e-4 SMART
SPEC 1128 1229 2.64e-4 SMART
SPEC 1236 1333 4.42e-6 SMART
coiled coil region 1375 1401 N/A INTRINSIC
SPEC 1438 1540 3.62e-2 SMART
SPEC 1547 1648 7.95e-1 SMART
SPEC 1655 1752 3.56e0 SMART
coiled coil region 1766 1795 N/A INTRINSIC
SPEC 1870 1972 3.63e0 SMART
SPEC 1979 2080 5.15e-16 SMART
SPEC 2087 2183 3.71e0 SMART
SPEC 2227 2330 4.7e-10 SMART
SPEC 2337 2437 1.02e0 SMART
SPEC 2444 2553 2.35e-10 SMART
SPEC 2560 2685 8.77e-10 SMART
SPEC 2692 2794 4.13e-6 SMART
WW 2811 2843 5.59e-7 SMART
Pfam:EF-hand_2 2844 2962 3.8e-41 PFAM
Pfam:EF-hand_3 2966 3057 1.6e-39 PFAM
ZnF_ZZ 3062 3107 6.33e-17 SMART
coiled coil region 3250 3289 N/A INTRINSIC
coiled coil region 3310 3354 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000218635
AA Change: L1134*
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.8%
Validation Efficiency 99% (84/85)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene shares both structural and functional similarities with the dystrophin gene. It contains an actin-binding N-terminus, a triple coiled-coil repeat central region, and a C-terminus that consists of protein-protein interaction motifs which interact with dystroglycan protein components. The protein encoded by this gene is located at the neuromuscular synapse and myotendinous junctions, where it participates in post-synaptic membrane maintenance and acetylcholine receptor clustering. Mouse studies suggest that this gene may serve as a functional substitute for the dystrophin gene and therefore, may serve as a potential therapeutic alternative to muscular dystrophy which is caused by mutations in the dystrophin gene. Alternative splicing of the utrophin gene has been described; however, the full-length nature of these variants has not yet been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants have reduced density of acetylcholine receptors and reduced number of junctional folds at neuromuscular junctions. Mice homozygous for utrophin and dystrophin knockouts die prematurely with severe, progressive muscular dystrophy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700086D15Rik A G 11: 65,152,530 probably benign Het
4931408C20Rik T C 1: 26,682,934 Y1055C probably benign Het
6430548M08Rik T C 8: 120,145,482 S50P probably damaging Het
Aacs A G 5: 125,506,163 D261G probably benign Het
Abcc4 T A 14: 118,594,894 T775S probably benign Het
Acsl6 A G 11: 54,341,756 probably null Het
Agbl5 T A 5: 30,904,717 F196I probably benign Het
Ahnak2 T C 12: 112,774,684 T985A possibly damaging Het
Ak1 A T 2: 32,631,122 D101V possibly damaging Het
Alx1 A G 10: 103,025,200 Y156H probably damaging Het
Angptl7 T A 4: 148,500,031 S87C probably benign Het
Ankrd36 A G 11: 5,629,299 T188A probably benign Het
Arhgap11a A C 2: 113,839,709 S356R possibly damaging Het
Ascc3 G T 10: 50,645,753 E455* probably null Het
Atp6v0a2 G A 5: 124,712,161 probably null Het
B3gnt7 T C 1: 86,305,694 W104R probably damaging Het
Bbs9 G A 9: 22,812,544 probably null Het
Cc2d2a T A 5: 43,703,215 D544E probably benign Het
Cic C T 7: 25,271,777 T311I probably benign Het
Cngb1 T A 8: 95,248,375 R1157W probably null Het
Cntln A G 4: 85,115,368 H1310R probably benign Het
Cntnap5c A T 17: 58,293,953 I764F probably benign Het
Col26a1 T C 5: 136,744,234 Q362R possibly damaging Het
Cyp2c29 G A 19: 39,291,141 R100K probably benign Het
D17H6S53E C G 17: 35,127,246 D44E probably damaging Het
Dap3 A G 3: 88,930,989 V65A probably damaging Het
Dna2 A T 10: 62,957,003 I266F probably damaging Het
Dnah14 G A 1: 181,585,066 G57E probably benign Het
Dock9 A T 14: 121,643,152 V333E probably benign Het
Dpm1 A G 2: 168,230,275 Y27H probably damaging Het
Dsp A T 13: 38,167,655 Y150F possibly damaging Het
Emilin3 A T 2: 160,908,098 I577N probably damaging Het
Erap1 A G 13: 74,671,433 T189A probably benign Het
Fam208a T A 14: 27,449,801 L397* probably null Het
Fat2 A G 11: 55,282,771 I2372T possibly damaging Het
Fbn2 A T 18: 58,124,187 probably null Het
Gnl1 A T 17: 35,987,533 R390* probably null Het
Hivep1 A G 13: 42,183,452 I2336V probably benign Het
Il17rb C G 14: 30,004,271 probably null Het
Itga9 T C 9: 118,887,815 W396R probably damaging Het
Katnal2 A G 18: 77,011,038 V152A probably benign Het
Kcnk3 A G 5: 30,622,400 T265A probably benign Het
Klhl1 T C 14: 96,136,594 Y672C probably benign Het
Leng8 C A 7: 4,143,626 N412K possibly damaging Het
Lrrc9 T A 12: 72,506,393 F1356L probably benign Het
Map7 A G 10: 20,171,082 probably benign Het
Mei1 T C 15: 82,081,930 F251S probably damaging Het
Mia2 A G 12: 59,129,895 E9G possibly damaging Het
Ms4a13 C A 19: 11,171,885 W182C probably benign Het
Muc16 C T 9: 18,660,299 R308K unknown Het
Olfr1195 G A 2: 88,683,684 T16I possibly damaging Het
Olfr936 A G 9: 39,047,531 probably benign Het
Pcnt A G 10: 76,385,798 V1998A probably benign Het
Pgm1 A T 5: 64,097,025 N51I probably benign Het
Piezo1 T A 8: 122,490,281 H1333L probably damaging Het
Prg2 G A 2: 84,983,256 V199M probably damaging Het
Prss51 T C 14: 64,097,488 V182A probably damaging Het
Psmb9 A T 17: 34,183,225 Y132* probably null Het
Ralyl T C 3: 13,777,031 Y76H probably damaging Het
Rnaset2a A T 17: 8,130,282 D174E probably benign Het
Rnft1 G A 11: 86,495,330 probably null Het
Robo2 T C 16: 73,961,867 Y676C probably damaging Het
Samd9l T G 6: 3,376,313 Y316S possibly damaging Het
Siah3 T A 14: 75,456,138 F28Y possibly damaging Het
Slc28a3 C T 13: 58,573,443 probably null Het
Slc8a1 A G 17: 81,388,872 F911S probably damaging Het
Speg T A 1: 75,387,908 L156* probably null Het
Spopl T G 2: 23,517,861 M269L probably benign Het
Tacr1 C T 6: 82,557,073 T360I probably benign Het
Tmem262 A G 19: 6,080,737 E95G probably benign Het
Tmem68 G T 4: 3,569,669 T7N possibly damaging Het
Top3a T A 11: 60,749,493 I460F probably damaging Het
Trafd1 G A 5: 121,384,074 R5* probably null Het
Trim16 T A 11: 62,840,869 V435D possibly damaging Het
Tspan17 A G 13: 54,796,033 D236G probably damaging Het
Tssk2 A T 16: 17,899,701 M323L probably benign Het
Ubqln5 A G 7: 104,129,008 V203A probably benign Het
Vmn1r37 C T 6: 66,731,720 S73F possibly damaging Het
Vps13c A G 9: 67,927,452 K1688E probably damaging Het
Zbtb39 A G 10: 127,741,842 D95G probably damaging Het
Zfhx3 T A 8: 108,800,528 I1019N probably damaging Het
Zfp207 C T 11: 80,395,503 probably benign Het
Zmiz1 C T 14: 25,643,638 T169M probably damaging Het
Other mutations in Utrn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00333:Utrn APN 10 12671830 missense probably damaging 1.00
IGL00469:Utrn APN 10 12406529 missense probably damaging 1.00
IGL00518:Utrn APN 10 12666843 splice site probably benign
IGL00560:Utrn APN 10 12455467 nonsense probably null
IGL00589:Utrn APN 10 12678618 missense possibly damaging 0.53
IGL00662:Utrn APN 10 12664961 missense probably damaging 0.99
IGL00754:Utrn APN 10 12663492 missense probably benign 0.05
IGL00772:Utrn APN 10 12649185 missense probably benign
IGL00775:Utrn APN 10 12745230 critical splice donor site probably null
IGL00782:Utrn APN 10 12652811 missense probably benign 0.13
IGL00962:Utrn APN 10 12481334 missense possibly damaging 0.80
IGL01584:Utrn APN 10 12726367 missense probably benign 0.01
IGL01677:Utrn APN 10 12744157 missense probably damaging 1.00
IGL01695:Utrn APN 10 12745342 missense probably benign 0.00
IGL01743:Utrn APN 10 12711557 missense possibly damaging 0.94
IGL01815:Utrn APN 10 12652716 missense probably benign 0.00
IGL01901:Utrn APN 10 12640928 missense probably damaging 1.00
IGL01982:Utrn APN 10 12748029 missense probably damaging 1.00
IGL01983:Utrn APN 10 12669781 missense probably benign 0.18
IGL02031:Utrn APN 10 12735204 missense probably damaging 1.00
IGL02106:Utrn APN 10 12413973 missense possibly damaging 0.92
IGL02134:Utrn APN 10 12643419 missense probably damaging 0.99
IGL02209:Utrn APN 10 12683295 missense probably damaging 0.97
IGL02217:Utrn APN 10 12751559 missense probably damaging 1.00
IGL02250:Utrn APN 10 12436391 missense probably damaging 1.00
IGL02307:Utrn APN 10 12750065 nonsense probably null
IGL02386:Utrn APN 10 12421608 missense possibly damaging 0.91
IGL02494:Utrn APN 10 12710054 missense probably benign
IGL02631:Utrn APN 10 12710063 missense probably benign 0.00
IGL02729:Utrn APN 10 12720810 unclassified probably benign
IGL02736:Utrn APN 10 12421640 missense probably damaging 1.00
IGL02832:Utrn APN 10 12738193 missense possibly damaging 0.82
IGL02926:Utrn APN 10 12690760 missense probably damaging 0.96
IGL03184:Utrn APN 10 12710166 missense probably benign 0.04
IGL03194:Utrn APN 10 12406429 splice site probably benign
IGL03346:Utrn APN 10 12525352 missense probably benign 0.22
retiring UTSW 10 12641020 missense probably damaging 1.00
shrinking_violet UTSW 10 12711585 critical splice acceptor site probably null
Wallflower UTSW 10 12747975 missense probably damaging 1.00
FR4548:Utrn UTSW 10 12633941 critical splice donor site probably benign
I2288:Utrn UTSW 10 12421640 missense probably damaging 1.00
PIT4677001:Utrn UTSW 10 12666704 missense probably benign 0.06
R0022:Utrn UTSW 10 12709956 splice site probably benign
R0024:Utrn UTSW 10 12406011 missense probably benign 0.00
R0024:Utrn UTSW 10 12406011 missense probably benign 0.00
R0026:Utrn UTSW 10 12726196 splice site probably benign
R0026:Utrn UTSW 10 12726196 splice site probably benign
R0091:Utrn UTSW 10 12735204 missense probably damaging 1.00
R0112:Utrn UTSW 10 12686465 nonsense probably null
R0126:Utrn UTSW 10 12711475 missense probably benign 0.02
R0184:Utrn UTSW 10 12667618 missense probably benign
R0219:Utrn UTSW 10 12684451 missense probably damaging 1.00
R0369:Utrn UTSW 10 12634022 missense probably benign 0.37
R0390:Utrn UTSW 10 12710060 missense probably benign 0.05
R0391:Utrn UTSW 10 12525333 splice site probably benign
R0408:Utrn UTSW 10 12384190 makesense probably null
R0409:Utrn UTSW 10 12643601 missense probably benign 0.01
R0441:Utrn UTSW 10 12688294 missense probably null 0.88
R0504:Utrn UTSW 10 12402895 missense probably benign 0.02
R0730:Utrn UTSW 10 12698158 splice site probably benign
R1078:Utrn UTSW 10 12455566 critical splice acceptor site probably null
R1171:Utrn UTSW 10 12481308 missense probably damaging 0.99
R1191:Utrn UTSW 10 12634033 missense probably benign 0.02
R1203:Utrn UTSW 10 12486537 missense probably damaging 1.00
R1401:Utrn UTSW 10 12649153 missense probably benign
R1418:Utrn UTSW 10 12713350 missense probably benign
R1439:Utrn UTSW 10 12744049 missense possibly damaging 0.79
R1441:Utrn UTSW 10 12683295 missense probably damaging 0.97
R1445:Utrn UTSW 10 12678574 splice site probably benign
R1509:Utrn UTSW 10 12455441 missense possibly damaging 0.91
R1546:Utrn UTSW 10 12436364 missense probably damaging 1.00
R1585:Utrn UTSW 10 12436285 missense possibly damaging 0.62
R1621:Utrn UTSW 10 12713283 missense probably benign 0.24
R1637:Utrn UTSW 10 12436364 missense probably damaging 1.00
R1703:Utrn UTSW 10 12727729 splice site probably benign
R1725:Utrn UTSW 10 12663519 missense probably damaging 0.99
R1735:Utrn UTSW 10 12710138 missense probably benign
R1770:Utrn UTSW 10 12475296 missense probably damaging 0.98
R1778:Utrn UTSW 10 12436364 missense probably damaging 1.00
R1783:Utrn UTSW 10 12463339 missense probably damaging 1.00
R1818:Utrn UTSW 10 12709964 critical splice donor site probably null
R1829:Utrn UTSW 10 12475274 missense probably damaging 1.00
R1919:Utrn UTSW 10 12455480 missense probably benign 0.15
R1964:Utrn UTSW 10 12684437 missense probably damaging 1.00
R2080:Utrn UTSW 10 12737082 missense probably benign 0.36
R2092:Utrn UTSW 10 12678698 missense probably benign 0.12
R2107:Utrn UTSW 10 12436364 missense probably damaging 1.00
R2108:Utrn UTSW 10 12436364 missense probably damaging 1.00
R2760:Utrn UTSW 10 12690878 missense probably damaging 1.00
R2884:Utrn UTSW 10 12739361 splice site probably null
R2885:Utrn UTSW 10 12739361 splice site probably null
R2886:Utrn UTSW 10 12739361 splice site probably null
R2903:Utrn UTSW 10 12643428 missense probably damaging 1.00
R2944:Utrn UTSW 10 12643419 missense probably damaging 1.00
R2945:Utrn UTSW 10 12486391 missense possibly damaging 0.50
R3438:Utrn UTSW 10 12481318 missense probably damaging 0.98
R3683:Utrn UTSW 10 12666835 missense probably benign 0.10
R3735:Utrn UTSW 10 12478484 missense probably damaging 1.00
R3907:Utrn UTSW 10 12710182 splice site probably benign
R3923:Utrn UTSW 10 12739479 missense probably benign 0.23
R3925:Utrn UTSW 10 12698042 missense probably benign
R3926:Utrn UTSW 10 12698042 missense probably benign
R3938:Utrn UTSW 10 12750030 critical splice donor site probably null
R3941:Utrn UTSW 10 12711585 critical splice acceptor site probably null
R3958:Utrn UTSW 10 12750108 missense probably damaging 1.00
R4091:Utrn UTSW 10 12710171 missense probably benign 0.10
R4454:Utrn UTSW 10 12727840 missense possibly damaging 0.81
R4585:Utrn UTSW 10 12688306 missense probably benign 0.01
R4667:Utrn UTSW 10 12698053 missense probably benign 0.22
R4684:Utrn UTSW 10 12745240 missense probably damaging 1.00
R4782:Utrn UTSW 10 12750069 missense probably damaging 1.00
R4785:Utrn UTSW 10 12654745 missense probably benign 0.39
R4799:Utrn UTSW 10 12750069 missense probably damaging 1.00
R4829:Utrn UTSW 10 12663461 missense probably benign 0.00
R4878:Utrn UTSW 10 12727758 missense probably damaging 1.00
R4955:Utrn UTSW 10 12861567 critical splice donor site probably null
R4967:Utrn UTSW 10 12455420 missense probably damaging 0.99
R5071:Utrn UTSW 10 12384204 splice site probably null
R5072:Utrn UTSW 10 12384204 splice site probably null
R5186:Utrn UTSW 10 12728777 missense probably damaging 1.00
R5213:Utrn UTSW 10 12636760 missense probably damaging 1.00
R5296:Utrn UTSW 10 12401355 missense probably damaging 1.00
R5309:Utrn UTSW 10 12727769 missense probably damaging 1.00
R5312:Utrn UTSW 10 12727769 missense probably damaging 1.00
R5399:Utrn UTSW 10 12640983 missense probably damaging 1.00
R5407:Utrn UTSW 10 12680625 missense probably damaging 1.00
R5411:Utrn UTSW 10 12649185 missense probably benign
R5428:Utrn UTSW 10 12693431 missense probably benign 0.09
R5595:Utrn UTSW 10 12682318 missense possibly damaging 0.89
R5602:Utrn UTSW 10 12750095 missense probably damaging 1.00
R5608:Utrn UTSW 10 12671837 missense probably benign 0.00
R5678:Utrn UTSW 10 12442018 missense probably damaging 1.00
R5726:Utrn UTSW 10 12669806 missense probably benign
R5804:Utrn UTSW 10 12421625 missense probably damaging 1.00
R5916:Utrn UTSW 10 12665051 missense probably damaging 0.97
R5941:Utrn UTSW 10 12486483 missense probably damaging 1.00
R6014:Utrn UTSW 10 12690876 missense probably benign 0.01
R6015:Utrn UTSW 10 12478424 missense possibly damaging 0.85
R6028:Utrn UTSW 10 12654716 missense probably benign 0.00
R6158:Utrn UTSW 10 12690822 missense probably benign 0.04
R6181:Utrn UTSW 10 12739456 missense probably damaging 1.00
R6300:Utrn UTSW 10 12501476 missense probably benign 0.35
R6367:Utrn UTSW 10 12747975 missense probably damaging 1.00
R6377:Utrn UTSW 10 12744083 missense probably damaging 1.00
R6434:Utrn UTSW 10 12525427 missense probably damaging 1.00
R6498:Utrn UTSW 10 12442093 missense probably benign
R6579:Utrn UTSW 10 12748006 missense probably benign 0.05
R6704:Utrn UTSW 10 12745291 missense probably damaging 0.99
R6736:Utrn UTSW 10 12621303 missense probably benign 0.09
R6755:Utrn UTSW 10 12699087 missense probably benign 0.00
R6793:Utrn UTSW 10 12640925 critical splice donor site probably null
R6793:Utrn UTSW 10 12699100 missense possibly damaging 0.69
R6835:Utrn UTSW 10 12727764 missense probably damaging 1.00
R6920:Utrn UTSW 10 12750470 missense probably damaging 0.98
R7037:Utrn UTSW 10 12826770 splice site probably null
R7038:Utrn UTSW 10 12682338 missense probably damaging 1.00
R7055:Utrn UTSW 10 12747921 missense probably benign 0.23
R7072:Utrn UTSW 10 12465213 missense probably damaging 1.00
R7090:Utrn UTSW 10 12684516 missense possibly damaging 0.58
R7211:Utrn UTSW 10 12401335 missense possibly damaging 0.72
R7248:Utrn UTSW 10 12728818 missense possibly damaging 0.51
R7305:Utrn UTSW 10 12385536 missense probably benign
R7334:Utrn UTSW 10 12728009 splice site probably null
R7348:Utrn UTSW 10 12748018 missense probably damaging 1.00
R7375:Utrn UTSW 10 12641020 missense probably damaging 1.00
R7436:Utrn UTSW 10 12439791 missense possibly damaging 0.72
R7476:Utrn UTSW 10 12640951 missense probably benign
R7514:Utrn UTSW 10 12698089 missense probably benign 0.00
R7527:Utrn UTSW 10 12401382 missense possibly damaging 0.81
R7735:Utrn UTSW 10 12744043 critical splice donor site probably null
R7748:Utrn UTSW 10 12614508 missense probably benign 0.01
R7778:Utrn UTSW 10 12486610 missense probably damaging 1.00
R7824:Utrn UTSW 10 12486610 missense probably damaging 1.00
R7826:Utrn UTSW 10 12401306 splice site probably null
R7872:Utrn UTSW 10 12698129 missense probably benign
R7915:Utrn UTSW 10 12465212 missense probably damaging 1.00
R7922:Utrn UTSW 10 12667527 missense possibly damaging 0.68
R8081:Utrn UTSW 10 12548059 start gained probably benign
R8132:Utrn UTSW 10 12682410 missense probably damaging 0.99
R8167:Utrn UTSW 10 12671814 nonsense probably null
R8186:Utrn UTSW 10 12698123 missense probably benign
R8331:Utrn UTSW 10 12614619 missense probably benign 0.00
R8352:Utrn UTSW 10 12813509 missense probably benign 0.34
R8408:Utrn UTSW 10 12670143 missense possibly damaging 0.69
R8452:Utrn UTSW 10 12813509 missense probably benign 0.34
R8478:Utrn UTSW 10 12649148 missense probably benign
R8489:Utrn UTSW 10 12711446 missense probably benign 0.05
R8516:Utrn UTSW 10 12486510 missense probably damaging 0.99
R8520:Utrn UTSW 10 12670186 nonsense probably null
R8550:Utrn UTSW 10 12813585 intron probably benign
RF009:Utrn UTSW 10 12633945 nonsense probably null
V1662:Utrn UTSW 10 12421640 missense probably damaging 1.00
X0018:Utrn UTSW 10 12735198 missense probably damaging 1.00
Z1176:Utrn UTSW 10 12682360 nonsense probably null
Z1176:Utrn UTSW 10 12688429 critical splice acceptor site probably null
Z1177:Utrn UTSW 10 12525406 nonsense probably null
Z1177:Utrn UTSW 10 12621379 missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- ACTTGTCCATAGGGTTCTGTGC -3'
(R):5'- TTTCTTACATTACACAGCACCAGC -3'

Sequencing Primer
(F):5'- TCTGTGCAGTGTGATAGGTGAAAGAC -3'
(R):5'- CAGCACCAGCACAGGATG -3'
Posted On2018-11-06