Incidental Mutation 'R6920:Fbxo28'
ID 539556
Institutional Source Beutler Lab
Gene Symbol Fbxo28
Ensembl Gene ENSMUSG00000047539
Gene Name F-box protein 28
Synonyms 5730505P19Rik, D1Ertd578e, Fbx28, 4833428J17Rik
MMRRC Submission 045040-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.787) question?
Stock # R6920 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 182140667-182169171 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 182168986 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Asparagine at position 51 (H51N)
Ref Sequence ENSEMBL: ENSMUSP00000141772 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051431] [ENSMUST00000192544] [ENSMUST00000194213] [ENSMUST00000195061]
AlphaFold Q8BIG4
Predicted Effect probably benign
Transcript: ENSMUST00000051431
AA Change: H57N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000054718
Gene: ENSMUSG00000047539
AA Change: H57N

DomainStartEndE-ValueType
low complexity region 2 55 N/A INTRINSIC
Pfam:F-box 63 94 7.8e-6 PFAM
coiled coil region 273 332 N/A INTRINSIC
low complexity region 335 344 N/A INTRINSIC
low complexity region 357 368 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000192544
AA Change: H57N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000141838
Gene: ENSMUSG00000047539
AA Change: H57N

DomainStartEndE-ValueType
low complexity region 2 55 N/A INTRINSIC
Pfam:F-box 62 101 8.7e-6 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000194213
AA Change: H57N

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000141219
Gene: ENSMUSG00000047539
AA Change: H57N

DomainStartEndE-ValueType
low complexity region 2 55 N/A INTRINSIC
Pfam:F-box 63 101 2e-5 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000195061
AA Change: H51N

PolyPhen 2 Score 0.235 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000141772
Gene: ENSMUSG00000047539
AA Change: H51N

DomainStartEndE-ValueType
low complexity region 7 49 N/A INTRINSIC
Pfam:F-box 56 95 1.1e-5 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.1%
  • 20x: 97.2%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the F-box protein family, such as FBXO28, are characterized by an approximately 40-amino acid F-box motif. SCF complexes, formed by SKP1 (MIM 601434), cullin (see CUL1; MIM 603134), and F-box proteins, act as protein-ubiquitin ligases. F-box proteins interact with SKP1 through the F box, and they interact with ubiquitination targets through other protein interaction domains (Jin et al., 2004 [PubMed 15520277]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A T 3: 137,773,811 (GRCm39) Y1000F probably damaging Het
1700018B08Rik A G 8: 122,262,160 (GRCm39) probably null Het
Aadat T C 8: 60,982,467 (GRCm39) F245L probably damaging Het
Adcy10 T G 1: 165,403,227 (GRCm39) L1575W probably damaging Het
Anks4b A T 7: 119,782,231 (GRCm39) T421S probably damaging Het
Anpep A T 7: 79,475,097 (GRCm39) I155N probably damaging Het
Arnt T C 3: 95,397,932 (GRCm39) F572L probably damaging Het
Brip1 G A 11: 86,039,362 (GRCm39) Q391* probably null Het
Brpf3 C A 17: 29,042,970 (GRCm39) H1004N probably benign Het
Cand2 T A 6: 115,768,250 (GRCm39) V465D possibly damaging Het
Card10 G T 15: 78,686,609 (GRCm39) Y69* probably null Het
Catsperd A T 17: 56,962,175 (GRCm39) K450* probably null Het
Ccdc137 T C 11: 120,351,009 (GRCm39) L137P probably damaging Het
Cic T C 7: 24,990,107 (GRCm39) S1905P probably damaging Het
Csmd3 C T 15: 47,507,601 (GRCm39) G2971S probably damaging Het
Dmxl2 A G 9: 54,379,496 (GRCm39) Y183H probably damaging Het
Drosha T C 15: 12,834,396 (GRCm39) Y167H unknown Het
E330034G19Rik A G 14: 24,358,310 (GRCm39) K214R unknown Het
Fam180a T G 6: 35,290,765 (GRCm39) I73L possibly damaging Het
Gm12728 T G 4: 105,647,533 (GRCm39) probably null Het
Gm973 T C 1: 59,591,620 (GRCm39) C335R possibly damaging Het
Gpx8 A G 13: 113,179,770 (GRCm39) V177A probably damaging Het
Hdlbp A G 1: 93,340,083 (GRCm39) probably null Het
Htt T G 5: 35,034,444 (GRCm39) Y1972D probably null Het
Igkv6-14 T C 6: 70,412,116 (GRCm39) Y56C possibly damaging Het
Kcnma1 A G 14: 23,576,602 (GRCm39) probably null Het
Klc1 T C 12: 111,754,019 (GRCm39) S105P probably damaging Het
Klhl20 T C 1: 160,921,266 (GRCm39) D63G possibly damaging Het
Lamc3 A G 2: 31,798,701 (GRCm39) D469G probably damaging Het
Lrit1 G C 14: 36,782,052 (GRCm39) V242L probably damaging Het
Mboat4 G A 8: 34,591,865 (GRCm39) R434H probably benign Het
Mttp T C 3: 137,821,043 (GRCm39) K270E possibly damaging Het
Muc5ac G A 7: 141,347,035 (GRCm39) C337Y possibly damaging Het
Nars1 A G 18: 64,634,471 (GRCm39) V484A probably damaging Het
Noxa1 G T 2: 24,981,844 (GRCm39) probably null Het
Or14c45 A G 7: 86,176,522 (GRCm39) T186A probably benign Het
Or7g18 T A 9: 18,786,821 (GRCm39) L63H probably damaging Het
Osbpl7 G A 11: 96,941,584 (GRCm39) G36S probably damaging Het
P4htm C T 9: 108,460,812 (GRCm39) G220D probably benign Het
Pcdhga7 A G 18: 37,848,199 (GRCm39) I69V probably benign Het
Pla2g4e C T 2: 120,015,795 (GRCm39) E250K possibly damaging Het
Plcd4 A G 1: 74,604,994 (GRCm39) probably benign Het
Ppfia3 C A 7: 45,008,231 (GRCm39) G213V possibly damaging Het
Ppp1r1a A G 15: 103,441,513 (GRCm39) S67P probably damaging Het
Prss43 T C 9: 110,657,680 (GRCm39) F193S probably benign Het
Rfx1 A G 8: 84,822,117 (GRCm39) Y872C probably damaging Het
Rhot1 T A 11: 80,132,921 (GRCm39) N218K probably benign Het
Sall1 A G 8: 89,757,021 (GRCm39) F1028L probably damaging Het
Siglec1 G A 2: 130,919,997 (GRCm39) Q845* probably null Het
Slc38a9 C T 13: 112,838,060 (GRCm39) T275I possibly damaging Het
Slc39a4 A T 15: 76,497,470 (GRCm39) S481T probably damaging Het
Ssr1 A T 13: 38,169,998 (GRCm39) N191K probably damaging Het
Tenm4 A T 7: 96,544,757 (GRCm39) S2258C probably damaging Het
Tm7sf3 T G 6: 146,507,645 (GRCm39) R472S possibly damaging Het
Tmprss11a G A 5: 86,576,494 (GRCm39) T119M probably benign Het
Traip C T 9: 107,838,240 (GRCm39) R142* probably null Het
Utrn T C 10: 12,626,214 (GRCm39) N100D probably damaging Het
Vmn1r74 T C 7: 11,581,575 (GRCm39) S292P probably benign Het
Vmn2r71 A T 7: 85,273,108 (GRCm39) I641F probably damaging Het
Vmn2r9 T A 5: 108,996,912 (GRCm39) Y119F possibly damaging Het
Vmn2r98 A G 17: 19,285,510 (GRCm39) N110S probably damaging Het
Vwce A G 19: 10,642,057 (GRCm39) T928A probably benign Het
Zfp608 T A 18: 55,121,337 (GRCm39) K83N probably damaging Het
Zfp808 A G 13: 62,320,982 (GRCm39) H737R probably benign Het
Zswim4 T C 8: 84,940,714 (GRCm39) N795S probably benign Het
Other mutations in Fbxo28
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01343:Fbxo28 APN 1 182,144,577 (GRCm39) missense probably damaging 0.96
IGL02936:Fbxo28 APN 1 182,169,093 (GRCm39) missense unknown
IGL03269:Fbxo28 APN 1 182,144,583 (GRCm39) missense possibly damaging 0.50
R0040:Fbxo28 UTSW 1 182,153,805 (GRCm39) intron probably benign
R0394:Fbxo28 UTSW 1 182,144,580 (GRCm39) missense probably benign 0.31
R1800:Fbxo28 UTSW 1 182,169,099 (GRCm39) missense unknown
R1846:Fbxo28 UTSW 1 182,153,845 (GRCm39) missense probably benign 0.02
R1891:Fbxo28 UTSW 1 182,145,389 (GRCm39) missense probably benign 0.35
R2113:Fbxo28 UTSW 1 182,157,490 (GRCm39) missense probably damaging 0.99
R2698:Fbxo28 UTSW 1 182,144,719 (GRCm39) missense probably benign 0.09
R4022:Fbxo28 UTSW 1 182,157,475 (GRCm39) missense possibly damaging 0.91
R4952:Fbxo28 UTSW 1 182,153,950 (GRCm39) missense probably damaging 1.00
R5167:Fbxo28 UTSW 1 182,145,558 (GRCm39) missense possibly damaging 0.71
R6196:Fbxo28 UTSW 1 182,157,454 (GRCm39) missense probably damaging 0.99
R6233:Fbxo28 UTSW 1 182,169,073 (GRCm39) missense unknown
R6935:Fbxo28 UTSW 1 182,169,025 (GRCm39) missense unknown
R7557:Fbxo28 UTSW 1 182,169,000 (GRCm39) missense unknown
R8906:Fbxo28 UTSW 1 182,144,634 (GRCm39) missense probably damaging 1.00
R9183:Fbxo28 UTSW 1 182,157,526 (GRCm39) missense possibly damaging 0.50
R9245:Fbxo28 UTSW 1 182,145,566 (GRCm39) missense possibly damaging 0.71
Z1176:Fbxo28 UTSW 1 182,145,435 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGGGTTGGAGGGACAATAC -3'
(R):5'- CCCCTTACATTGGAGGAAGG -3'

Sequencing Primer
(F):5'- AGTGAACTCCAGAGCCCGAG -3'
(R):5'- TCAAACTCCCAAGATGGCGG -3'
Posted On 2018-11-06