Mutagenetix > Incidental Mutation

Incidental Mutation 'R6920:Lamc3'

539558

Institutional Source

Beutler Lab

Gene Symbol

Lamc3

Ensembl Gene

ENSMUSG00000026840

Gene Name

laminin gamma 3

Synonyms

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6920 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

31887291-31946539 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 31908689 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 469 (D469G)

Ref Sequence

ENSEMBL: ENSMUSP00000118745 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028187] [ENSMUST00000138325]

AlphaFold

Q9R0B6

Predicted Effect

probably benign
Transcript: ENSMUST00000028187
AA Change: D469G

PolyPhen 2 Score 0.150 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000028187
Gene: ENSMUSG00000026840
AA Change: D469G

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
LamNT	38	278	4.32e-115	SMART
EGF_Lam	280	333	4.19e-8	SMART
EGF_Lam	336	389	4.81e-8	SMART
EGF_Lam	392	436	2.52e-11	SMART
EGF_Lam	439	486	1.16e-10	SMART
low complexity region	538	549	N/A	INTRINSIC
low complexity region	591	603	N/A	INTRINSIC
EGF_like	649	716	3.69e0	SMART
EGF_Lam	719	764	3.1e-11	SMART
EGF_Lam	767	819	3.43e-4	SMART
EGF_Lam	822	875	2.16e-10	SMART
EGF_Lam	878	925	6.29e-12	SMART
EGF_Lam	928	973	1.62e-14	SMART
EGF_Lam	976	1021	1.02e-6	SMART
low complexity region	1032	1046	N/A	INTRINSIC
coiled coil region	1119	1150	N/A	INTRINSIC
low complexity region	1234	1247	N/A	INTRINSIC
low complexity region	1397	1407	N/A	INTRINSIC
coiled coil region	1444	1467	N/A	INTRINSIC
coiled coil region	1528	1575	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000138325
AA Change: D469G

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000118745
Gene: ENSMUSG00000026840
AA Change: D469G

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
LamNT	38	278	4.32e-115	SMART
EGF_Lam	280	333	4.19e-8	SMART
EGF_Lam	336	389	4.81e-8	SMART
EGF_Lam	392	436	2.52e-11	SMART
EGF_Lam	439	486	1.16e-10	SMART
low complexity region	538	549	N/A	INTRINSIC
low complexity region	591	603	N/A	INTRINSIC
EGF_like	649	716	3.69e0	SMART
EGF_Lam	719	764	3.1e-11	SMART
EGF_Lam	767	819	3.43e-4	SMART
EGF_Lam	822	875	2.16e-10	SMART
EGF_Lam	878	925	6.29e-12	SMART
EGF_Lam	928	973	1.62e-14	SMART
EGF_Lam	976	1021	1.02e-6	SMART
low complexity region	1032	1046	N/A	INTRINSIC
coiled coil region	1119	1150	N/A	INTRINSIC
low complexity region	1245	1258	N/A	INTRINSIC
low complexity region	1408	1418	N/A	INTRINSIC
coiled coil region	1455	1478	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.1%
20x: 97.2%

Validation Efficiency

100% (65/65)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Laminins, a family of extracellular matrix glycoproteins, are the major noncollagenous constituent of basement membranes. They have been implicated in a wide variety of biological processes including cell adhesion, differentiation, migration, signaling, neurite outgrowth and metastasis. Laminins are composed of 3 non identical chains: laminin alpha, beta and gamma (formerly A, B1, and B2, respectively) and they form a cruciform structure consisting of 3 short arms, each formed by a different chain, and a long arm composed of all 3 chains. Each laminin chain is a multidomain protein encoded by a distinct gene. Several isoforms of each chain have been described. Different alpha, beta and gamma chain isomers combine to give rise to different heterotrimeric laminin isoforms which are designated by Arabic numerals in the order of their discovery, i.e. alpha1beta1gamma1 heterotrimer is laminin 1. The biological functions of the different chains and trimer molecules are largely unknown, but some of the chains have been shown to differ with respect to their tissue distribution, presumably reflecting diverse functions in vivo. This gene encodes the gamma chain isoform laminin, gamma 3. The gamma 3 chain is most similar to the gamma 1 chain, and contains all the 6 domains expected of the gamma chain. It is a component of laminin 12. The gamma 3 chain is broadly expressed in skin, heart, lung, and the reproductive tracts. In skin, it is seen within the basement membrane of the dermal-epidermal junction at points of nerve penetration. Gamma 3 is also a prominent element of the apical surface of ciliated epithelial cells of lung, oviduct, epididymis, ductus deferens, and seminiferous tubules. The distribution of gamma 3-containing laminins along ciliated epithelial surfaces suggests that the apical laminins are important in the morphogenesis and structural stability of the ciliated processes of these cells. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for a reporter allele exhibit abnormal amacrine cell morphology. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110002E22Rik	A	T	3: 138,068,050	Y1000F	probably damaging	Het
1700018B08Rik	A	G	8: 121,535,421		probably null	Het
Aadat	T	C	8: 60,529,433	F245L	probably damaging	Het
Adcy10	T	G	1: 165,575,658	L1575W	probably damaging	Het
Anks4b	A	T	7: 120,183,008	T421S	probably damaging	Het
Anpep	A	T	7: 79,825,349	I155N	probably damaging	Het
Arnt	T	C	3: 95,490,621	F572L	probably damaging	Het
Brip1	G	A	11: 86,148,536	Q391*	probably null	Het
Brpf3	C	A	17: 28,823,996	H1004N	probably benign	Het
Cand2	T	A	6: 115,791,289	V465D	possibly damaging	Het
Card10	G	T	15: 78,802,409	Y69*	probably null	Het
Catsperd	A	T	17: 56,655,175	K450*	probably null	Het
Ccdc137	T	C	11: 120,460,183	L137P	probably damaging	Het
Cic	T	C	7: 25,290,682	S1905P	probably damaging	Het
Csmd3	C	T	15: 47,644,205	G2971S	probably damaging	Het
Dmxl2	A	G	9: 54,472,212	Y183H	probably damaging	Het
Drosha	T	C	15: 12,834,310	Y167H	unknown	Het
E330034G19Rik	A	G	14: 24,308,242	K214R	unknown	Het
Fam180a	T	G	6: 35,313,830	I73L	possibly damaging	Het
Fbxo28	G	T	1: 182,341,421	H51N	probably benign	Het
Gm12728	T	G	4: 105,790,336		probably null	Het
Gm973	T	C	1: 59,552,461	C335R	possibly damaging	Het
Gpx8	A	G	13: 113,043,236	V177A	probably damaging	Het
Hdlbp	A	G	1: 93,412,361		probably null	Het
Htt	T	G	5: 34,877,100	Y1972D	probably null	Het
Igkv6-14	T	C	6: 70,435,132	Y56C	possibly damaging	Het
Kcnma1	A	G	14: 23,526,534		probably null	Het
Klc1	T	C	12: 111,787,585	S105P	probably damaging	Het
Klhl20	T	C	1: 161,093,696	D63G	possibly damaging	Het
Lrit1	G	C	14: 37,060,095	V242L	probably damaging	Het
Mboat4	G	A	8: 34,124,711	R434H	probably benign	Het
Mttp	T	C	3: 138,115,282	K270E	possibly damaging	Het
Muc5ac	G	A	7: 141,793,298	C337Y	possibly damaging	Het
Nars	A	G	18: 64,501,400	V484A	probably damaging	Het
Noxa1	G	T	2: 25,091,832		probably null	Het
Olfr297	A	G	7: 86,527,314	T186A	probably benign	Het
Olfr830	T	A	9: 18,875,525	L63H	probably damaging	Het
Osbpl7	G	A	11: 97,050,758	G36S	probably damaging	Het
P4htm	C	T	9: 108,583,613	G220D	probably benign	Het
Pcdhga7	A	G	18: 37,715,146	I69V	probably benign	Het
Pla2g4e	C	T	2: 120,185,314	E250K	possibly damaging	Het
Plcd4	A	G	1: 74,565,835		probably benign	Het
Ppfia3	C	A	7: 45,358,807	G213V	possibly damaging	Het
Ppp1r1a	A	G	15: 103,533,086	S67P	probably damaging	Het
Prss43	T	C	9: 110,828,612	F193S	probably benign	Het
Rfx1	A	G	8: 84,095,488	Y872C	probably damaging	Het
Rhot1	T	A	11: 80,242,095	N218K	probably benign	Het
Sall1	A	G	8: 89,030,393	F1028L	probably damaging	Het
Siglec1	G	A	2: 131,078,077	Q845*	probably null	Het
Slc38a9	C	T	13: 112,701,526	T275I	possibly damaging	Het
Slc39a4	A	T	15: 76,613,270	S481T	probably damaging	Het
Ssr1	A	T	13: 37,986,022	N191K	probably damaging	Het
Tenm4	A	T	7: 96,895,550	S2258C	probably damaging	Het
Tm7sf3	T	G	6: 146,606,147	R472S	possibly damaging	Het
Tmprss11a	G	A	5: 86,428,635	T119M	probably benign	Het
Traip	C	T	9: 107,961,041	R142*	probably null	Het
Utrn	T	C	10: 12,750,470	N100D	probably damaging	Het
Vmn1r74	T	C	7: 11,847,648	S292P	probably benign	Het
Vmn2r71	A	T	7: 85,623,900	I641F	probably damaging	Het
Vmn2r9	T	A	5: 108,849,046	Y119F	possibly damaging	Het
Vmn2r98	A	G	17: 19,065,248	N110S	probably damaging	Het
Vwce	A	G	19: 10,664,693	T928A	probably benign	Het
Zfp608	T	A	18: 54,988,265	K83N	probably damaging	Het
Zfp808	A	G	13: 62,173,168	H737R	probably benign	Het
Zswim4	T	C	8: 84,214,085	N795S	probably benign	Het

Other mutations in Lamc3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00582:Lamc3	APN	2	31900581	missense	probably damaging	0.99
IGL00823:Lamc3	APN	2	31918521	missense	probably damaging	1.00
IGL01020:Lamc3	APN	2	31914656	missense	probably benign	0.07
IGL01086:Lamc3	APN	2	31898476	missense	probably damaging	1.00
IGL01618:Lamc3	APN	2	31912107	missense	probably damaging	0.99
IGL01655:Lamc3	APN	2	31898278	missense	probably damaging	1.00
IGL02093:Lamc3	APN	2	31887655	missense	probably damaging	1.00
IGL02309:Lamc3	APN	2	31914604	splice site	probably benign
IGL02340:Lamc3	APN	2	31918457	missense	probably damaging	1.00
IGL02410:Lamc3	APN	2	31905965	missense	probably damaging	0.99
IGL02548:Lamc3	APN	2	31920662	missense	probably benign	0.00
IGL02679:Lamc3	APN	2	31945398	missense	probably benign	0.01
IGL02751:Lamc3	APN	2	31920704	missense	probably benign	0.07
IGL02820:Lamc3	APN	2	31923022	missense	probably damaging	1.00
IGL02926:Lamc3	APN	2	31935725	splice site	probably benign
IGL02926:Lamc3	APN	2	31935726	splice site	probably benign
IGL03090:Lamc3	APN	2	31908698	splice site	probably benign
IGL03258:Lamc3	APN	2	31887683	missense	probably damaging	1.00
R0005:Lamc3	UTSW	2	31922428	missense	probably benign	0.07
R0137:Lamc3	UTSW	2	31908616	missense	probably damaging	1.00
R0179:Lamc3	UTSW	2	31915084	splice site	probably benign
R0244:Lamc3	UTSW	2	31940721	missense	probably damaging	1.00
R0512:Lamc3	UTSW	2	31937968	missense	probably damaging	1.00
R1052:Lamc3	UTSW	2	31928802	missense	probably benign	0.03
R1142:Lamc3	UTSW	2	31940721	missense	probably damaging	1.00
R1366:Lamc3	UTSW	2	31928847	missense	probably damaging	1.00
R1463:Lamc3	UTSW	2	31887411	missense	probably benign
R1515:Lamc3	UTSW	2	31940751	missense	probably damaging	1.00
R1642:Lamc3	UTSW	2	31915996	missense	probably damaging	1.00
R1692:Lamc3	UTSW	2	31921781	missense	probably null	0.01
R1707:Lamc3	UTSW	2	31912129	critical splice donor site	probably null
R1714:Lamc3	UTSW	2	31940757	missense	probably benign	0.02
R1838:Lamc3	UTSW	2	31925582	missense	possibly damaging	0.89
R2940:Lamc3	UTSW	2	31940702	missense	probably benign	0.02
R3177:Lamc3	UTSW	2	31908625	missense	probably damaging	1.00
R3277:Lamc3	UTSW	2	31908625	missense	probably damaging	1.00
R3846:Lamc3	UTSW	2	31924592	missense	probably benign	0.01
R4065:Lamc3	UTSW	2	31945258	missense	probably benign	0.00
R4089:Lamc3	UTSW	2	31920508	nonsense	probably null
R4373:Lamc3	UTSW	2	31898232	missense	probably damaging	1.00
R4394:Lamc3	UTSW	2	31931952	missense	probably benign
R4395:Lamc3	UTSW	2	31931952	missense	probably benign
R4397:Lamc3	UTSW	2	31931952	missense	probably benign
R4746:Lamc3	UTSW	2	31905614	missense	possibly damaging	0.77
R4948:Lamc3	UTSW	2	31940736	missense	probably benign	0.02
R4960:Lamc3	UTSW	2	31915954	missense	probably benign	0.00
R5025:Lamc3	UTSW	2	31908669	missense	probably benign	0.13
R5062:Lamc3	UTSW	2	31905667	missense	possibly damaging	0.60
R5170:Lamc3	UTSW	2	31887344	start codon destroyed	probably benign	0.03
R5286:Lamc3	UTSW	2	31918596	missense	probably damaging	1.00
R5457:Lamc3	UTSW	2	31931985	missense	probably benign
R5655:Lamc3	UTSW	2	31925717	missense	probably benign	0.01
R5928:Lamc3	UTSW	2	31921709	missense	probably benign	0.00
R6018:Lamc3	UTSW	2	31905712	missense	probably damaging	1.00
R6479:Lamc3	UTSW	2	31887401	missense	probably benign
R6601:Lamc3	UTSW	2	31920532	missense	possibly damaging	0.94
R6924:Lamc3	UTSW	2	31938069	missense	probably benign
R7114:Lamc3	UTSW	2	31930645	missense	probably damaging	0.99
R7305:Lamc3	UTSW	2	31930702	missense	probably benign	0.39
R7559:Lamc3	UTSW	2	31922368	missense	probably benign	0.00
R7714:Lamc3	UTSW	2	31922267	splice site	probably null
R7787:Lamc3	UTSW	2	31900539	missense	probably damaging	0.99
R7819:Lamc3	UTSW	2	31921763	missense	probably benign
R8171:Lamc3	UTSW	2	31914971	missense	probably benign	0.06
R8208:Lamc3	UTSW	2	31887414	missense	possibly damaging	0.47
R8412:Lamc3	UTSW	2	31912116	missense	probably damaging	0.98
R9058:Lamc3	UTSW	2	31908641	missense	probably benign	0.01
R9242:Lamc3	UTSW	2	31898311	missense	probably benign	0.14
R9269:Lamc3	UTSW	2	31923005	missense	probably benign	0.11
R9269:Lamc3	UTSW	2	31928896	nonsense	probably null
X0010:Lamc3	UTSW	2	31938012	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GTCCCTGTTCTTCTGAGGATG -3'
(R):5'- GTTCCCACAGGGCCTTTGG -3'

Sequencing Primer
(F):5'- CCTGTTCTTCTGAGGATGGGGAATC -3'
(R):5'- CCCAAGGACAACTCTTAATTTGGGG -3'

Posted On

2018-11-06