Incidental Mutation 'R6920:Arnt'
ID539561
Institutional Source Beutler Lab
Gene Symbol Arnt
Ensembl Gene ENSMUSG00000015522
Gene Namearyl hydrocarbon receptor nuclear translocator
SynonymsESTM42, Hif1b, D3Ertd557e, bHLHe2
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6920 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location95434388-95497240 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 95490621 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 572 (F572L)
Ref Sequence ENSEMBL: ENSMUSP00000015666 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015666] [ENSMUST00000090804] [ENSMUST00000102749] [ENSMUST00000107161] [ENSMUST00000136413]
Predicted Effect probably damaging
Transcript: ENSMUST00000015666
AA Change: F572L

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000015666
Gene: ENSMUSG00000015522
AA Change: F572L

DomainStartEndE-ValueType
low complexity region 24 34 N/A INTRINSIC
HLH 69 128 2.9e-11 SMART
PAS 143 210 7.4e-13 SMART
low complexity region 231 242 N/A INTRINSIC
PAS 332 397 7.6e-10 SMART
PAC 404 447 9.6e-7 SMART
low complexity region 705 718 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000090804
AA Change: F577L

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000088313
Gene: ENSMUSG00000015522
AA Change: F577L

DomainStartEndE-ValueType
low complexity region 24 34 N/A INTRINSIC
HLH 80 133 1e-14 SMART
PAS 148 215 1.51e-10 SMART
low complexity region 236 247 N/A INTRINSIC
PAS 337 402 1.55e-7 SMART
PAC 409 452 1.95e-4 SMART
low complexity region 710 723 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000102749
AA Change: F592L

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000099810
Gene: ENSMUSG00000015522
AA Change: F592L

DomainStartEndE-ValueType
low complexity region 24 34 N/A INTRINSIC
HLH 95 148 1e-14 SMART
PAS 163 230 1.51e-10 SMART
low complexity region 251 262 N/A INTRINSIC
PAS 352 417 1.55e-7 SMART
PAC 424 467 1.95e-4 SMART
low complexity region 725 738 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000107161
AA Change: F577L

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000102779
Gene: ENSMUSG00000015522
AA Change: F577L

DomainStartEndE-ValueType
low complexity region 24 34 N/A INTRINSIC
HLH 80 133 1e-14 SMART
PAS 148 215 1.51e-10 SMART
low complexity region 236 247 N/A INTRINSIC
PAS 337 402 1.55e-7 SMART
PAC 409 452 1.95e-4 SMART
low complexity region 694 707 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000136413
SMART Domains Protein: ENSMUSP00000116688
Gene: ENSMUSG00000015522

DomainStartEndE-ValueType
low complexity region 12 23 N/A INTRINSIC
Blast:PAS 97 126 7e-8 BLAST
PDB:2B02|A 97 126 5e-9 PDB
Meta Mutation Damage Score 0.1889 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.1%
  • 20x: 97.2%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing a basic helix-loop-helix domain and two characteristic PAS domains along with a PAC domain. The encoded protein binds to ligand-bound aryl hydrocarbon receptor and aids in the movement of this complex to the nucleus, where it promotes the expression of genes involved in xenobiotic metabolism. This protein is also a co-factor for transcriptional regulation by hypoxia-inducible factor 1. Chromosomal translocation of this locus with the ETV6 (ets variant 6) gene on chromosome 12 have been described in leukemias. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2013]
PHENOTYPE: Homozygotes for targeted null mutations exhibit loss of aryl hydrocarbon receptor and hypoxia-inducible factor 1 alpha gene induction, defective angiogenesis of the yolk sac and branchial arches, placental defects, and lethality by embryonic day 10.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A T 3: 138,068,050 Y1000F probably damaging Het
1700018B08Rik A G 8: 121,535,421 probably null Het
Aadat T C 8: 60,529,433 F245L probably damaging Het
Adcy10 T G 1: 165,575,658 L1575W probably damaging Het
Anks4b A T 7: 120,183,008 T421S probably damaging Het
Anpep A T 7: 79,825,349 I155N probably damaging Het
Brip1 G A 11: 86,148,536 Q391* probably null Het
Brpf3 C A 17: 28,823,996 H1004N probably benign Het
Cand2 T A 6: 115,791,289 V465D possibly damaging Het
Card10 G T 15: 78,802,409 Y69* probably null Het
Catsperd A T 17: 56,655,175 K450* probably null Het
Ccdc137 T C 11: 120,460,183 L137P probably damaging Het
Cic T C 7: 25,290,682 S1905P probably damaging Het
Csmd3 C T 15: 47,644,205 G2971S probably damaging Het
Dmxl2 A G 9: 54,472,212 Y183H probably damaging Het
Drosha T C 15: 12,834,310 Y167H unknown Het
E330034G19Rik A G 14: 24,308,242 K214R unknown Het
Fam180a T G 6: 35,313,830 I73L possibly damaging Het
Fbxo28 G T 1: 182,341,421 H51N probably benign Het
Gm12728 T G 4: 105,790,336 probably null Het
Gm973 T C 1: 59,552,461 C335R possibly damaging Het
Gpx8 A G 13: 113,043,236 V177A probably damaging Het
Hdlbp A G 1: 93,412,361 probably null Het
Htt T G 5: 34,877,100 Y1972D probably null Het
Igkv6-14 T C 6: 70,435,132 Y56C possibly damaging Het
Kcnma1 A G 14: 23,526,534 probably null Het
Klc1 T C 12: 111,787,585 S105P probably damaging Het
Klhl20 T C 1: 161,093,696 D63G possibly damaging Het
Lamc3 A G 2: 31,908,689 D469G probably damaging Het
Lrit1 G C 14: 37,060,095 V242L probably damaging Het
Mboat4 G A 8: 34,124,711 R434H probably benign Het
Mttp T C 3: 138,115,282 K270E possibly damaging Het
Muc5ac G A 7: 141,793,298 C337Y possibly damaging Het
Nars A G 18: 64,501,400 V484A probably damaging Het
Noxa1 G T 2: 25,091,832 probably null Het
Olfr297 A G 7: 86,527,314 T186A probably benign Het
Olfr830 T A 9: 18,875,525 L63H probably damaging Het
Osbpl7 G A 11: 97,050,758 G36S probably damaging Het
P4htm C T 9: 108,583,613 G220D probably benign Het
Pcdhga7 A G 18: 37,715,146 I69V probably benign Het
Pla2g4e C T 2: 120,185,314 E250K possibly damaging Het
Plcd4 A G 1: 74,565,835 probably benign Het
Ppfia3 C A 7: 45,358,807 G213V possibly damaging Het
Ppp1r1a A G 15: 103,533,086 S67P probably damaging Het
Prss43 T C 9: 110,828,612 F193S probably benign Het
Rfx1 A G 8: 84,095,488 Y872C probably damaging Het
Rhot1 T A 11: 80,242,095 N218K probably benign Het
Sall1 A G 8: 89,030,393 F1028L probably damaging Het
Siglec1 G A 2: 131,078,077 Q845* probably null Het
Slc38a9 C T 13: 112,701,526 T275I possibly damaging Het
Slc39a4 A T 15: 76,613,270 S481T probably damaging Het
Ssr1 A T 13: 37,986,022 N191K probably damaging Het
Tenm4 A T 7: 96,895,550 S2258C probably damaging Het
Tm7sf3 T G 6: 146,606,147 R472S possibly damaging Het
Tmprss11a G A 5: 86,428,635 T119M probably benign Het
Traip C T 9: 107,961,041 R142* probably null Het
Utrn T C 10: 12,750,470 N100D probably damaging Het
Vmn1r74 T C 7: 11,847,648 S292P probably benign Het
Vmn2r71 A T 7: 85,623,900 I641F probably damaging Het
Vmn2r9 T A 5: 108,849,046 Y119F possibly damaging Het
Vmn2r98 A G 17: 19,065,248 N110S probably damaging Het
Vwce A G 19: 10,664,693 T928A probably benign Het
Zfp608 T A 18: 54,988,265 K83N probably damaging Het
Zfp808 A G 13: 62,173,168 H737R probably benign Het
Zswim4 T C 8: 84,214,085 N795S probably benign Het
Other mutations in Arnt
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00835:Arnt APN 3 95490340 missense probably damaging 0.98
IGL00949:Arnt APN 3 95487268 missense probably damaging 1.00
IGL01304:Arnt APN 3 95448385 missense probably damaging 1.00
IGL01634:Arnt APN 3 95470398 splice site probably benign
IGL01685:Arnt APN 3 95474681 missense probably damaging 1.00
IGL01768:Arnt APN 3 95491016 unclassified probably benign
IGL02738:Arnt APN 3 95495320 unclassified probably null
IGL02941:Arnt APN 3 95460370 splice site probably benign
R0211:Arnt UTSW 3 95476149 missense probably damaging 1.00
R0211:Arnt UTSW 3 95476149 missense probably damaging 1.00
R0420:Arnt UTSW 3 95470394 splice site probably benign
R0801:Arnt UTSW 3 95493846 missense possibly damaging 0.86
R1418:Arnt UTSW 3 95470399 splice site probably benign
R1523:Arnt UTSW 3 95489654 missense possibly damaging 0.77
R1956:Arnt UTSW 3 95448393 missense possibly damaging 0.94
R1957:Arnt UTSW 3 95448393 missense possibly damaging 0.94
R1958:Arnt UTSW 3 95448393 missense possibly damaging 0.94
R1969:Arnt UTSW 3 95448393 missense possibly damaging 0.94
R1970:Arnt UTSW 3 95448393 missense possibly damaging 0.94
R1971:Arnt UTSW 3 95448393 missense possibly damaging 0.94
R3743:Arnt UTSW 3 95474705 missense possibly damaging 0.49
R4561:Arnt UTSW 3 95452613 missense probably damaging 0.96
R4780:Arnt UTSW 3 95488385 missense probably damaging 1.00
R4827:Arnt UTSW 3 95489913 unclassified probably null
R4913:Arnt UTSW 3 95490654 missense probably damaging 1.00
R5051:Arnt UTSW 3 95470337 missense probably benign 0.08
R5572:Arnt UTSW 3 95474704 missense possibly damaging 0.49
R5866:Arnt UTSW 3 95490726 unclassified probably benign
R6376:Arnt UTSW 3 95490625 missense probably damaging 0.99
R6491:Arnt UTSW 3 95476143 missense probably damaging 1.00
R6873:Arnt UTSW 3 95474575 missense probably damaging 1.00
R7485:Arnt UTSW 3 95495348 missense probably damaging 1.00
R7731:Arnt UTSW 3 95483775 missense probably benign 0.33
R7786:Arnt UTSW 3 95484956 missense probably damaging 0.96
R7797:Arnt UTSW 3 95480261 critical splice donor site probably null
X0020:Arnt UTSW 3 95494565 missense probably benign 0.10
X0026:Arnt UTSW 3 95474630 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCTCCTTTTACAGGCTGAG -3'
(R):5'- AAAGCAGCTTCGTTGTCTCACC -3'

Sequencing Primer
(F):5'- TCATTATTACTGATGGGACTGCC -3'
(R):5'- GTCTCACCCTAGGTCCAGTAAG -3'
Posted On2018-11-06