Incidental Mutation 'R6920:Mttp'
ID 539563
Institutional Source Beutler Lab
Gene Symbol Mttp
Ensembl Gene ENSMUSG00000028158
Gene Name microsomal triglyceride transfer protein
Synonyms 1810043K16Rik, MTP
MMRRC Submission 045040-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.885) question?
Stock # R6920 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 137795616-137849179 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 137821043 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Glutamic Acid at position 270 (K270E)
Ref Sequence ENSEMBL: ENSMUSP00000096179 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029805] [ENSMUST00000098580]
AlphaFold O08601
Predicted Effect probably benign
Transcript: ENSMUST00000029805
AA Change: K255E

PolyPhen 2 Score 0.292 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000029805
Gene: ENSMUSG00000028158
AA Change: K255E

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
LPD_N 28 579 8.87e-165 SMART
Blast:LPD_N 582 695 4e-58 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000098580
AA Change: K270E

PolyPhen 2 Score 0.485 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000096179
Gene: ENSMUSG00000028158
AA Change: K270E

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
LPD_N 43 594 8.87e-165 SMART
Blast:LPD_N 597 710 6e-58 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.1%
  • 20x: 97.2%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] MTP encodes the large subunit of the heterodimeric microsomal triglyceride transfer protein. Protein disulfide isomerase (PDI) completes the heterodimeric microsomal triglyceride transfer protein, which has been shown to play a central role in lipoprotein assembly. Mutations in MTP can cause abetalipoproteinemia. [provided by RefSeq, Jul 2008]
PHENOTYPE: Most embryos homozygous for a reporter allele die at midgestation displaying delayed growth, neurodevelopmental anomalies, impaired erythropoiesis, deficient yolk sac lipoprotein production, hemorrhage and necrosis. Heterozygous mutant mice display altered plasma lipid and lipoprotein profiles. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A T 3: 137,773,811 (GRCm39) Y1000F probably damaging Het
1700018B08Rik A G 8: 122,262,160 (GRCm39) probably null Het
Aadat T C 8: 60,982,467 (GRCm39) F245L probably damaging Het
Adcy10 T G 1: 165,403,227 (GRCm39) L1575W probably damaging Het
Anks4b A T 7: 119,782,231 (GRCm39) T421S probably damaging Het
Anpep A T 7: 79,475,097 (GRCm39) I155N probably damaging Het
Arnt T C 3: 95,397,932 (GRCm39) F572L probably damaging Het
Brip1 G A 11: 86,039,362 (GRCm39) Q391* probably null Het
Brpf3 C A 17: 29,042,970 (GRCm39) H1004N probably benign Het
Cand2 T A 6: 115,768,250 (GRCm39) V465D possibly damaging Het
Card10 G T 15: 78,686,609 (GRCm39) Y69* probably null Het
Catsperd A T 17: 56,962,175 (GRCm39) K450* probably null Het
Ccdc137 T C 11: 120,351,009 (GRCm39) L137P probably damaging Het
Cic T C 7: 24,990,107 (GRCm39) S1905P probably damaging Het
Csmd3 C T 15: 47,507,601 (GRCm39) G2971S probably damaging Het
Dmxl2 A G 9: 54,379,496 (GRCm39) Y183H probably damaging Het
Drosha T C 15: 12,834,396 (GRCm39) Y167H unknown Het
E330034G19Rik A G 14: 24,358,310 (GRCm39) K214R unknown Het
Fam180a T G 6: 35,290,765 (GRCm39) I73L possibly damaging Het
Fbxo28 G T 1: 182,168,986 (GRCm39) H51N probably benign Het
Gm12728 T G 4: 105,647,533 (GRCm39) probably null Het
Gm973 T C 1: 59,591,620 (GRCm39) C335R possibly damaging Het
Gpx8 A G 13: 113,179,770 (GRCm39) V177A probably damaging Het
Hdlbp A G 1: 93,340,083 (GRCm39) probably null Het
Htt T G 5: 35,034,444 (GRCm39) Y1972D probably null Het
Igkv6-14 T C 6: 70,412,116 (GRCm39) Y56C possibly damaging Het
Kcnma1 A G 14: 23,576,602 (GRCm39) probably null Het
Klc1 T C 12: 111,754,019 (GRCm39) S105P probably damaging Het
Klhl20 T C 1: 160,921,266 (GRCm39) D63G possibly damaging Het
Lamc3 A G 2: 31,798,701 (GRCm39) D469G probably damaging Het
Lrit1 G C 14: 36,782,052 (GRCm39) V242L probably damaging Het
Mboat4 G A 8: 34,591,865 (GRCm39) R434H probably benign Het
Muc5ac G A 7: 141,347,035 (GRCm39) C337Y possibly damaging Het
Nars1 A G 18: 64,634,471 (GRCm39) V484A probably damaging Het
Noxa1 G T 2: 24,981,844 (GRCm39) probably null Het
Or14c45 A G 7: 86,176,522 (GRCm39) T186A probably benign Het
Or7g18 T A 9: 18,786,821 (GRCm39) L63H probably damaging Het
Osbpl7 G A 11: 96,941,584 (GRCm39) G36S probably damaging Het
P4htm C T 9: 108,460,812 (GRCm39) G220D probably benign Het
Pcdhga7 A G 18: 37,848,199 (GRCm39) I69V probably benign Het
Pla2g4e C T 2: 120,015,795 (GRCm39) E250K possibly damaging Het
Plcd4 A G 1: 74,604,994 (GRCm39) probably benign Het
Ppfia3 C A 7: 45,008,231 (GRCm39) G213V possibly damaging Het
Ppp1r1a A G 15: 103,441,513 (GRCm39) S67P probably damaging Het
Prss43 T C 9: 110,657,680 (GRCm39) F193S probably benign Het
Rfx1 A G 8: 84,822,117 (GRCm39) Y872C probably damaging Het
Rhot1 T A 11: 80,132,921 (GRCm39) N218K probably benign Het
Sall1 A G 8: 89,757,021 (GRCm39) F1028L probably damaging Het
Siglec1 G A 2: 130,919,997 (GRCm39) Q845* probably null Het
Slc38a9 C T 13: 112,838,060 (GRCm39) T275I possibly damaging Het
Slc39a4 A T 15: 76,497,470 (GRCm39) S481T probably damaging Het
Ssr1 A T 13: 38,169,998 (GRCm39) N191K probably damaging Het
Tenm4 A T 7: 96,544,757 (GRCm39) S2258C probably damaging Het
Tm7sf3 T G 6: 146,507,645 (GRCm39) R472S possibly damaging Het
Tmprss11a G A 5: 86,576,494 (GRCm39) T119M probably benign Het
Traip C T 9: 107,838,240 (GRCm39) R142* probably null Het
Utrn T C 10: 12,626,214 (GRCm39) N100D probably damaging Het
Vmn1r74 T C 7: 11,581,575 (GRCm39) S292P probably benign Het
Vmn2r71 A T 7: 85,273,108 (GRCm39) I641F probably damaging Het
Vmn2r9 T A 5: 108,996,912 (GRCm39) Y119F possibly damaging Het
Vmn2r98 A G 17: 19,285,510 (GRCm39) N110S probably damaging Het
Vwce A G 19: 10,642,057 (GRCm39) T928A probably benign Het
Zfp608 T A 18: 55,121,337 (GRCm39) K83N probably damaging Het
Zfp808 A G 13: 62,320,982 (GRCm39) H737R probably benign Het
Zswim4 T C 8: 84,940,714 (GRCm39) N795S probably benign Het
Other mutations in Mttp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00722:Mttp APN 3 137,814,776 (GRCm39) missense possibly damaging 0.84
IGL00983:Mttp APN 3 137,820,890 (GRCm39) splice site probably benign
IGL01128:Mttp APN 3 137,839,758 (GRCm39) splice site probably null
IGL01607:Mttp APN 3 137,810,459 (GRCm39) missense probably damaging 0.99
IGL01760:Mttp APN 3 137,817,497 (GRCm39) missense probably benign 0.00
IGL01947:Mttp APN 3 137,812,890 (GRCm39) missense probably damaging 1.00
IGL02184:Mttp APN 3 137,821,761 (GRCm39) critical splice donor site probably null
IGL02932:Mttp APN 3 137,817,505 (GRCm39) missense probably benign 0.07
IGL02957:Mttp APN 3 137,814,842 (GRCm39) missense possibly damaging 0.95
IGL03082:Mttp APN 3 137,829,556 (GRCm39) missense probably benign 0.01
IGL03302:Mttp APN 3 137,810,468 (GRCm39) missense possibly damaging 0.90
IGL03381:Mttp APN 3 137,810,704 (GRCm39) missense probably damaging 1.00
G1patch:Mttp UTSW 3 137,812,999 (GRCm39) missense probably damaging 1.00
P0040:Mttp UTSW 3 137,818,327 (GRCm39) missense possibly damaging 0.82
R0543:Mttp UTSW 3 137,817,457 (GRCm39) missense possibly damaging 0.75
R0738:Mttp UTSW 3 137,809,074 (GRCm39) missense probably damaging 1.00
R0967:Mttp UTSW 3 137,798,484 (GRCm39) missense probably benign 0.00
R1281:Mttp UTSW 3 137,812,980 (GRCm39) missense possibly damaging 0.95
R1565:Mttp UTSW 3 137,822,166 (GRCm39) critical splice donor site probably null
R1660:Mttp UTSW 3 137,808,954 (GRCm39) missense probably damaging 1.00
R1828:Mttp UTSW 3 137,813,041 (GRCm39) missense probably damaging 1.00
R1886:Mttp UTSW 3 137,798,376 (GRCm39) missense probably damaging 1.00
R1912:Mttp UTSW 3 137,821,788 (GRCm39) missense probably benign 0.01
R1938:Mttp UTSW 3 137,830,882 (GRCm39) missense probably benign 0.21
R2020:Mttp UTSW 3 137,824,163 (GRCm39) missense probably damaging 0.98
R2109:Mttp UTSW 3 137,800,763 (GRCm39) missense probably benign 0.27
R2336:Mttp UTSW 3 137,821,856 (GRCm39) missense possibly damaging 0.81
R2392:Mttp UTSW 3 137,800,782 (GRCm39) missense probably damaging 0.98
R3021:Mttp UTSW 3 137,817,464 (GRCm39) missense probably benign
R3774:Mttp UTSW 3 137,820,024 (GRCm39) splice site probably null
R3776:Mttp UTSW 3 137,820,024 (GRCm39) splice site probably null
R4687:Mttp UTSW 3 137,798,496 (GRCm39) missense possibly damaging 0.66
R4708:Mttp UTSW 3 137,839,859 (GRCm39) unclassified probably benign
R4756:Mttp UTSW 3 137,821,832 (GRCm39) missense possibly damaging 0.77
R4832:Mttp UTSW 3 137,821,811 (GRCm39) missense probably benign
R5377:Mttp UTSW 3 137,810,790 (GRCm39) missense probably benign 0.03
R5670:Mttp UTSW 3 137,830,874 (GRCm39) missense probably damaging 0.99
R6613:Mttp UTSW 3 137,814,839 (GRCm39) missense probably damaging 1.00
R6725:Mttp UTSW 3 137,812,999 (GRCm39) missense probably damaging 1.00
R6799:Mttp UTSW 3 137,800,841 (GRCm39) missense probably benign 0.04
R7074:Mttp UTSW 3 137,813,034 (GRCm39) missense possibly damaging 0.53
R7131:Mttp UTSW 3 137,821,893 (GRCm39) missense probably benign 0.13
R7275:Mttp UTSW 3 137,829,546 (GRCm39) missense probably benign 0.19
R7291:Mttp UTSW 3 137,796,964 (GRCm39) missense probably damaging 1.00
R7310:Mttp UTSW 3 137,800,783 (GRCm39) missense probably damaging 1.00
R7769:Mttp UTSW 3 137,808,873 (GRCm39) missense probably damaging 1.00
R7909:Mttp UTSW 3 137,824,178 (GRCm39) nonsense probably null
R8037:Mttp UTSW 3 137,796,883 (GRCm39) missense probably damaging 1.00
R8220:Mttp UTSW 3 137,829,609 (GRCm39) missense probably benign 0.00
R8335:Mttp UTSW 3 137,808,973 (GRCm39) missense possibly damaging 0.90
R8352:Mttp UTSW 3 137,818,374 (GRCm39) missense probably damaging 1.00
R8452:Mttp UTSW 3 137,818,374 (GRCm39) missense probably damaging 1.00
R8536:Mttp UTSW 3 137,810,704 (GRCm39) missense probably damaging 1.00
R8677:Mttp UTSW 3 137,810,437 (GRCm39) missense probably benign 0.00
R8877:Mttp UTSW 3 137,818,317 (GRCm39) missense probably damaging 0.99
R9233:Mttp UTSW 3 137,822,280 (GRCm39) missense probably damaging 1.00
R9237:Mttp UTSW 3 137,810,444 (GRCm39) missense probably benign
R9427:Mttp UTSW 3 137,820,962 (GRCm39) missense probably benign 0.01
R9749:Mttp UTSW 3 137,830,989 (GRCm39) missense probably damaging 0.99
R9797:Mttp UTSW 3 137,814,725 (GRCm39) missense probably damaging 0.96
Z1176:Mttp UTSW 3 137,810,540 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- ACTAGCAATTACCTCTGCTGC -3'
(R):5'- AAACAATGTCGTTGGGGTTCAAG -3'

Sequencing Primer
(F):5'- TAGCAATTACCTCTGCTGCAGAAAG -3'
(R):5'- CAAGGTGTCTCTGGAGATGCC -3'
Posted On 2018-11-06