Mutagenetix > Incidental Mutation

Incidental Mutation 'R6920:Vmn2r71'

539576

Institutional Source

Beutler Lab

Gene Symbol

Vmn2r71

Ensembl Gene

ENSMUSG00000091205

Gene Name

vomeronasal 2, receptor 71

Synonyms

EG233445

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.072) question?

Stock #

R6920 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

85574614-85624547 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 85623900 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Phenylalanine at position 641 (I641F)

Ref Sequence

ENSEMBL: ENSMUSP00000132337 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000172338]

AlphaFold

L7N2D8

Predicted Effect

probably damaging
Transcript: ENSMUST00000172338
AA Change: I641F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000132337
Gene: ENSMUSG00000091205
AA Change: I641F

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
Pfam:ANF_receptor	77	468	2.1e-31	PFAM
Pfam:NCD3G	511	563	8.7e-20	PFAM
Pfam:7tm_3	593	831	2e-55	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.1%
20x: 97.2%

Validation Efficiency

100% (65/65)

Allele List at MGI

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110002E22Rik	A	T	3: 138,068,050	Y1000F	probably damaging	Het
1700018B08Rik	A	G	8: 121,535,421		probably null	Het
Aadat	T	C	8: 60,529,433	F245L	probably damaging	Het
Adcy10	T	G	1: 165,575,658	L1575W	probably damaging	Het
Anks4b	A	T	7: 120,183,008	T421S	probably damaging	Het
Anpep	A	T	7: 79,825,349	I155N	probably damaging	Het
Arnt	T	C	3: 95,490,621	F572L	probably damaging	Het
Brip1	G	A	11: 86,148,536	Q391*	probably null	Het
Brpf3	C	A	17: 28,823,996	H1004N	probably benign	Het
Cand2	T	A	6: 115,791,289	V465D	possibly damaging	Het
Card10	G	T	15: 78,802,409	Y69*	probably null	Het
Catsperd	A	T	17: 56,655,175	K450*	probably null	Het
Ccdc137	T	C	11: 120,460,183	L137P	probably damaging	Het
Cic	T	C	7: 25,290,682	S1905P	probably damaging	Het
Csmd3	C	T	15: 47,644,205	G2971S	probably damaging	Het
Dmxl2	A	G	9: 54,472,212	Y183H	probably damaging	Het
Drosha	T	C	15: 12,834,310	Y167H	unknown	Het
E330034G19Rik	A	G	14: 24,308,242	K214R	unknown	Het
Fam180a	T	G	6: 35,313,830	I73L	possibly damaging	Het
Fbxo28	G	T	1: 182,341,421	H51N	probably benign	Het
Gm12728	T	G	4: 105,790,336		probably null	Het
Gm973	T	C	1: 59,552,461	C335R	possibly damaging	Het
Gpx8	A	G	13: 113,043,236	V177A	probably damaging	Het
Hdlbp	A	G	1: 93,412,361		probably null	Het
Htt	T	G	5: 34,877,100	Y1972D	probably null	Het
Igkv6-14	T	C	6: 70,435,132	Y56C	possibly damaging	Het
Kcnma1	A	G	14: 23,526,534		probably null	Het
Klc1	T	C	12: 111,787,585	S105P	probably damaging	Het
Klhl20	T	C	1: 161,093,696	D63G	possibly damaging	Het
Lamc3	A	G	2: 31,908,689	D469G	probably damaging	Het
Lrit1	G	C	14: 37,060,095	V242L	probably damaging	Het
Mboat4	G	A	8: 34,124,711	R434H	probably benign	Het
Mttp	T	C	3: 138,115,282	K270E	possibly damaging	Het
Muc5ac	G	A	7: 141,793,298	C337Y	possibly damaging	Het
Nars	A	G	18: 64,501,400	V484A	probably damaging	Het
Noxa1	G	T	2: 25,091,832		probably null	Het
Olfr297	A	G	7: 86,527,314	T186A	probably benign	Het
Olfr830	T	A	9: 18,875,525	L63H	probably damaging	Het
Osbpl7	G	A	11: 97,050,758	G36S	probably damaging	Het
P4htm	C	T	9: 108,583,613	G220D	probably benign	Het
Pcdhga7	A	G	18: 37,715,146	I69V	probably benign	Het
Pla2g4e	C	T	2: 120,185,314	E250K	possibly damaging	Het
Plcd4	A	G	1: 74,565,835		probably benign	Het
Ppfia3	C	A	7: 45,358,807	G213V	possibly damaging	Het
Ppp1r1a	A	G	15: 103,533,086	S67P	probably damaging	Het
Prss43	T	C	9: 110,828,612	F193S	probably benign	Het
Rfx1	A	G	8: 84,095,488	Y872C	probably damaging	Het
Rhot1	T	A	11: 80,242,095	N218K	probably benign	Het
Sall1	A	G	8: 89,030,393	F1028L	probably damaging	Het
Siglec1	G	A	2: 131,078,077	Q845*	probably null	Het
Slc38a9	C	T	13: 112,701,526	T275I	possibly damaging	Het
Slc39a4	A	T	15: 76,613,270	S481T	probably damaging	Het
Ssr1	A	T	13: 37,986,022	N191K	probably damaging	Het
Tenm4	A	T	7: 96,895,550	S2258C	probably damaging	Het
Tm7sf3	T	G	6: 146,606,147	R472S	possibly damaging	Het
Tmprss11a	G	A	5: 86,428,635	T119M	probably benign	Het
Traip	C	T	9: 107,961,041	R142*	probably null	Het
Utrn	T	C	10: 12,750,470	N100D	probably damaging	Het
Vmn1r74	T	C	7: 11,847,648	S292P	probably benign	Het
Vmn2r9	T	A	5: 108,849,046	Y119F	possibly damaging	Het
Vmn2r98	A	G	17: 19,065,248	N110S	probably damaging	Het
Vwce	A	G	19: 10,664,693	T928A	probably benign	Het
Zfp608	T	A	18: 54,988,265	K83N	probably damaging	Het
Zfp808	A	G	13: 62,173,168	H737R	probably benign	Het
Zswim4	T	C	8: 84,214,085	N795S	probably benign	Het

Other mutations in Vmn2r71

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00922:Vmn2r71	APN	7	85618693	missense	probably benign
IGL00960:Vmn2r71	APN	7	85624374	missense	probably damaging	1.00
IGL01372:Vmn2r71	APN	7	85620814	splice site	probably benign
IGL01690:Vmn2r71	APN	7	85615574	missense	probably damaging	1.00
IGL01909:Vmn2r71	APN	7	85620793	missense	probably benign	0.00
IGL01950:Vmn2r71	APN	7	85615619	missense	probably damaging	0.98
IGL02570:Vmn2r71	APN	7	85615540	missense	possibly damaging	0.95
IGL02650:Vmn2r71	APN	7	85624327	missense	probably damaging	1.00
IGL02901:Vmn2r71	APN	7	85619262	missense	probably benign	0.00
IGL03128:Vmn2r71	APN	7	85619587	missense	probably damaging	1.00
IGL03328:Vmn2r71	APN	7	85624291	missense	probably damaging	1.00
R0533:Vmn2r71	UTSW	7	85619218	frame shift	probably null
R0707:Vmn2r71	UTSW	7	85619432	missense	probably benign
R0841:Vmn2r71	UTSW	7	85618541	missense	possibly damaging	0.62
R0865:Vmn2r71	UTSW	7	85619308	missense	probably benign	0.01
R0883:Vmn2r71	UTSW	7	85623634	missense	probably benign	0.19
R0939:Vmn2r71	UTSW	7	85623681	missense	possibly damaging	0.70
R1597:Vmn2r71	UTSW	7	85624144	missense	possibly damaging	0.46
R1646:Vmn2r71	UTSW	7	85621268	missense	probably damaging	0.99
R1719:Vmn2r71	UTSW	7	85621227	missense	probably damaging	1.00
R1860:Vmn2r71	UTSW	7	85615574	missense	probably damaging	1.00
R2013:Vmn2r71	UTSW	7	85620637	missense	probably benign	0.38
R2014:Vmn2r71	UTSW	7	85620637	missense	probably benign	0.38
R2015:Vmn2r71	UTSW	7	85620637	missense	probably benign	0.38
R2050:Vmn2r71	UTSW	7	85624473	missense	probably damaging	1.00
R2084:Vmn2r71	UTSW	7	85618737	missense	probably benign	0.03
R2221:Vmn2r71	UTSW	7	85624093	missense	probably benign	0.40
R2223:Vmn2r71	UTSW	7	85624093	missense	probably benign	0.40
R2245:Vmn2r71	UTSW	7	85624180	missense	probably damaging	1.00
R3115:Vmn2r71	UTSW	7	85623658	missense	probably damaging	0.97
R3122:Vmn2r71	UTSW	7	85615620	nonsense	probably null
R3609:Vmn2r71	UTSW	7	85619662	missense	probably damaging	1.00
R4093:Vmn2r71	UTSW	7	85621234	missense	probably benign	0.00
R4305:Vmn2r71	UTSW	7	85624152	missense	probably damaging	1.00
R4306:Vmn2r71	UTSW	7	85624152	missense	probably damaging	1.00
R4334:Vmn2r71	UTSW	7	85619834	missense	probably benign	0.01
R4569:Vmn2r71	UTSW	7	85624194	missense	possibly damaging	0.66
R4622:Vmn2r71	UTSW	7	85620609	missense	probably benign	0.00
R4915:Vmn2r71	UTSW	7	85621268	missense	probably damaging	0.99
R4956:Vmn2r71	UTSW	7	85619228	missense	probably benign	0.19
R5005:Vmn2r71	UTSW	7	85624144	missense	probably damaging	1.00
R5045:Vmn2r71	UTSW	7	85624389	missense	probably benign	0.00
R5153:Vmn2r71	UTSW	7	85619222	missense	possibly damaging	0.94
R5236:Vmn2r71	UTSW	7	85623669	missense	probably damaging	1.00
R5373:Vmn2r71	UTSW	7	85618542	missense	possibly damaging	0.79
R5405:Vmn2r71	UTSW	7	85619414	missense	probably benign
R5831:Vmn2r71	UTSW	7	85623714	missense	probably benign	0.16
R6061:Vmn2r71	UTSW	7	85619274	missense	probably benign
R6518:Vmn2r71	UTSW	7	85621228	missense	probably damaging	1.00
R6751:Vmn2r71	UTSW	7	85619887	critical splice donor site	probably null
R7358:Vmn2r71	UTSW	7	85624260	missense	possibly damaging	0.81
R7453:Vmn2r71	UTSW	7	85624089	missense	probably benign	0.21
R7560:Vmn2r71	UTSW	7	85623907	missense	probably benign	0.06
R7871:Vmn2r71	UTSW	7	85623661	missense	possibly damaging	0.81
R8267:Vmn2r71	UTSW	7	85615496	missense	probably benign	0.02
R8377:Vmn2r71	UTSW	7	85615499	missense	probably benign
R9278:Vmn2r71	UTSW	7	85620580	missense	probably benign	0.19
R9319:Vmn2r71	UTSW	7	85624486	missense	probably damaging	1.00
R9329:Vmn2r71	UTSW	7	85618742	missense	probably benign	0.00
R9368:Vmn2r71	UTSW	7	85624234	missense	probably damaging	1.00
R9636:Vmn2r71	UTSW	7	85619180	missense	possibly damaging	0.80
R9756:Vmn2r71	UTSW	7	85619365	nonsense	probably null
X0025:Vmn2r71	UTSW	7	85618665	missense	probably benign
Z1186:Vmn2r71	UTSW	7	85623886	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AATGAAGACCATACTCTCTGTCTC -3'
(R):5'- TTTGGGTGCTCCTGACTCAG -3'

Sequencing Primer
(F):5'- CTCTGTCTCCAAAAAGTTGTGG -3'
(R):5'- TGACTCAGGCATCCACCTC -3'

Posted On

2018-11-06