Incidental Mutation 'R6920:Anks4b'
ID539579
Institutional Source Beutler Lab
Gene Symbol Anks4b
Ensembl Gene ENSMUSG00000030909
Gene Nameankyrin repeat and sterile alpha motif domain containing 4B
Synonyms2010013E14Rik, Harp
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6920 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location120173858-120185586 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 120183008 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 421 (T421S)
Ref Sequence ENSEMBL: ENSMUSP00000033201 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033198] [ENSMUST00000033201]
Predicted Effect probably benign
Transcript: ENSMUST00000033198
SMART Domains Protein: ENSMUSP00000033198
Gene: ENSMUSG00000030905

DomainStartEndE-ValueType
Pfam:OCD_Mu_crystall 3 313 7.1e-113 PFAM
Pfam:Shikimate_DH 124 227 7.1e-11 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000033201
AA Change: T421S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000033201
Gene: ENSMUSG00000030909
AA Change: T421S

DomainStartEndE-ValueType
ANK 31 60 1.03e-2 SMART
ANK 64 93 6.3e-7 SMART
ANK 97 126 3.69e2 SMART
coiled coil region 131 165 N/A INTRINSIC
low complexity region 170 189 N/A INTRINSIC
coiled coil region 303 335 N/A INTRINSIC
SAM 346 411 6.52e-8 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.1%
  • 20x: 97.2%
Validation Efficiency 100% (65/65)
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A T 3: 138,068,050 Y1000F probably damaging Het
1700018B08Rik A G 8: 121,535,421 probably null Het
Aadat T C 8: 60,529,433 F245L probably damaging Het
Adcy10 T G 1: 165,575,658 L1575W probably damaging Het
Anpep A T 7: 79,825,349 I155N probably damaging Het
Arnt T C 3: 95,490,621 F572L probably damaging Het
Brip1 G A 11: 86,148,536 Q391* probably null Het
Brpf3 C A 17: 28,823,996 H1004N probably benign Het
Cand2 T A 6: 115,791,289 V465D possibly damaging Het
Card10 G T 15: 78,802,409 Y69* probably null Het
Catsperd A T 17: 56,655,175 K450* probably null Het
Ccdc137 T C 11: 120,460,183 L137P probably damaging Het
Cic T C 7: 25,290,682 S1905P probably damaging Het
Csmd3 C T 15: 47,644,205 G2971S probably damaging Het
Dmxl2 A G 9: 54,472,212 Y183H probably damaging Het
Drosha T C 15: 12,834,310 Y167H unknown Het
E330034G19Rik A G 14: 24,308,242 K214R unknown Het
Fam180a T G 6: 35,313,830 I73L possibly damaging Het
Fbxo28 G T 1: 182,341,421 H51N probably benign Het
Gm12728 T G 4: 105,790,336 probably null Het
Gm973 T C 1: 59,552,461 C335R possibly damaging Het
Gpx8 A G 13: 113,043,236 V177A probably damaging Het
Hdlbp A G 1: 93,412,361 probably null Het
Htt T G 5: 34,877,100 Y1972D probably null Het
Igkv6-14 T C 6: 70,435,132 Y56C possibly damaging Het
Kcnma1 A G 14: 23,526,534 probably null Het
Klc1 T C 12: 111,787,585 S105P probably damaging Het
Klhl20 T C 1: 161,093,696 D63G possibly damaging Het
Lamc3 A G 2: 31,908,689 D469G probably damaging Het
Lrit1 G C 14: 37,060,095 V242L probably damaging Het
Mboat4 G A 8: 34,124,711 R434H probably benign Het
Mttp T C 3: 138,115,282 K270E possibly damaging Het
Muc5ac G A 7: 141,793,298 C337Y possibly damaging Het
Nars A G 18: 64,501,400 V484A probably damaging Het
Noxa1 G T 2: 25,091,832 probably null Het
Olfr297 A G 7: 86,527,314 T186A probably benign Het
Olfr830 T A 9: 18,875,525 L63H probably damaging Het
Osbpl7 G A 11: 97,050,758 G36S probably damaging Het
P4htm C T 9: 108,583,613 G220D probably benign Het
Pcdhga7 A G 18: 37,715,146 I69V probably benign Het
Pla2g4e C T 2: 120,185,314 E250K possibly damaging Het
Plcd4 A G 1: 74,565,835 probably benign Het
Ppfia3 C A 7: 45,358,807 G213V possibly damaging Het
Ppp1r1a A G 15: 103,533,086 S67P probably damaging Het
Prss43 T C 9: 110,828,612 F193S probably benign Het
Rfx1 A G 8: 84,095,488 Y872C probably damaging Het
Rhot1 T A 11: 80,242,095 N218K probably benign Het
Sall1 A G 8: 89,030,393 F1028L probably damaging Het
Siglec1 G A 2: 131,078,077 Q845* probably null Het
Slc38a9 C T 13: 112,701,526 T275I possibly damaging Het
Slc39a4 A T 15: 76,613,270 S481T probably damaging Het
Ssr1 A T 13: 37,986,022 N191K probably damaging Het
Tenm4 A T 7: 96,895,550 S2258C probably damaging Het
Tm7sf3 T G 6: 146,606,147 R472S possibly damaging Het
Tmprss11a G A 5: 86,428,635 T119M probably benign Het
Traip C T 9: 107,961,041 R142* probably null Het
Utrn T C 10: 12,750,470 N100D probably damaging Het
Vmn1r74 T C 7: 11,847,648 S292P probably benign Het
Vmn2r71 A T 7: 85,623,900 I641F probably damaging Het
Vmn2r9 T A 5: 108,849,046 Y119F possibly damaging Het
Vmn2r98 A G 17: 19,065,248 N110S probably damaging Het
Vwce A G 19: 10,664,693 T928A probably benign Het
Zfp608 T A 18: 54,988,265 K83N probably damaging Het
Zfp808 A G 13: 62,173,168 H737R probably benign Het
Zswim4 T C 8: 84,214,085 N795S probably benign Het
Other mutations in Anks4b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01060:Anks4b APN 7 120173925 missense possibly damaging 0.69
IGL01830:Anks4b APN 7 120173996 missense probably damaging 1.00
IGL02490:Anks4b APN 7 120174018 missense probably damaging 1.00
IGL02820:Anks4b APN 7 120182691 unclassified probably benign
IGL03074:Anks4b APN 7 120181917 missense probably damaging 1.00
R0383:Anks4b UTSW 7 120182874 missense probably damaging 1.00
R0747:Anks4b UTSW 7 120182163 missense probably damaging 0.96
R1125:Anks4b UTSW 7 120182357 missense possibly damaging 0.66
R1192:Anks4b UTSW 7 120174066 missense probably benign 0.02
R3079:Anks4b UTSW 7 120181923 missense probably damaging 1.00
R3080:Anks4b UTSW 7 120181923 missense probably damaging 1.00
R5542:Anks4b UTSW 7 120182423 nonsense probably null
R5954:Anks4b UTSW 7 120182173 missense possibly damaging 0.92
R6001:Anks4b UTSW 7 120182718 missense probably benign 0.30
R7921:Anks4b UTSW 7 120182769 missense probably benign 0.12
R7946:Anks4b UTSW 7 120182484 missense probably benign 0.00
R7966:Anks4b UTSW 7 120182700 missense probably benign 0.00
R8755:Anks4b UTSW 7 120174084 critical splice donor site probably null
Z1088:Anks4b UTSW 7 120182519 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TCTCAGCACCTGGAGGAATTC -3'
(R):5'- AAGGTCTCCCAAGGTCTTTTC -3'

Sequencing Primer
(F):5'- CCTTCCCATTTTTATGAGAGAACAG -3'
(R):5'- CCAAGGTCTTTTCTCATTGATGG -3'
Posted On2018-11-06