Incidental Mutation 'R6920:Rfx1'
ID539583
Institutional Source Beutler Lab
Gene Symbol Rfx1
Ensembl Gene ENSMUSG00000031706
Gene Nameregulatory factor X, 1 (influences HLA class II expression)
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6920 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location84066834-84096992 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 84095488 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 872 (Y872C)
Ref Sequence ENSEMBL: ENSMUSP00000147677 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005600] [ENSMUST00000041367] [ENSMUST00000210279] [ENSMUST00000211046]
Predicted Effect probably damaging
Transcript: ENSMUST00000005600
AA Change: Y872C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000005600
Gene: ENSMUSG00000031706
AA Change: Y872C

DomainStartEndE-ValueType
low complexity region 11 47 N/A INTRINSIC
low complexity region 53 67 N/A INTRINSIC
low complexity region 73 92 N/A INTRINSIC
Pfam:RFX1_trans_act 106 176 9.6e-9 PFAM
Pfam:RFX1_trans_act 211 366 1.8e-59 PFAM
Pfam:RFX_DNA_binding 420 498 2.5e-35 PFAM
Blast:HisKA 705 768 3e-28 BLAST
low complexity region 908 920 N/A INTRINSIC
low complexity region 932 948 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000041367
SMART Domains Protein: ENSMUSP00000038568
Gene: ENSMUSG00000037103

DomainStartEndE-ValueType
low complexity region 12 33 N/A INTRINSIC
Pfam:DCAF15_WD40 48 259 1.1e-84 PFAM
low complexity region 275 294 N/A INTRINSIC
low complexity region 343 359 N/A INTRINSIC
low complexity region 374 384 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000210279
Predicted Effect probably damaging
Transcript: ENSMUST00000211046
AA Change: Y872C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.1%
  • 20x: 97.2%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the regulatory factor X (RFX) family of transcription factors, which are characterized by a winged-helix DNA-binding domain. The encoded transcription factor contains an N-terminal activation domain and a C-terminal repression domain, and may activate or repress target gene expression depending on cellular context. This transcription factor has been shown to regulate a wide variety of genes involved in immunity and cancer, including the MHC class II genes and genes that may be involved in cancer progression. This gene exhibits altered expression in glioblastoma and the autoimmune disease systemic lupus erythematosis (SLE). [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous for a gene trap allele die prior to implantation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A T 3: 138,068,050 Y1000F probably damaging Het
1700018B08Rik A G 8: 121,535,421 probably null Het
Aadat T C 8: 60,529,433 F245L probably damaging Het
Adcy10 T G 1: 165,575,658 L1575W probably damaging Het
Anks4b A T 7: 120,183,008 T421S probably damaging Het
Anpep A T 7: 79,825,349 I155N probably damaging Het
Arnt T C 3: 95,490,621 F572L probably damaging Het
Brip1 G A 11: 86,148,536 Q391* probably null Het
Brpf3 C A 17: 28,823,996 H1004N probably benign Het
Cand2 T A 6: 115,791,289 V465D possibly damaging Het
Card10 G T 15: 78,802,409 Y69* probably null Het
Catsperd A T 17: 56,655,175 K450* probably null Het
Ccdc137 T C 11: 120,460,183 L137P probably damaging Het
Cic T C 7: 25,290,682 S1905P probably damaging Het
Csmd3 C T 15: 47,644,205 G2971S probably damaging Het
Dmxl2 A G 9: 54,472,212 Y183H probably damaging Het
Drosha T C 15: 12,834,310 Y167H unknown Het
E330034G19Rik A G 14: 24,308,242 K214R unknown Het
Fam180a T G 6: 35,313,830 I73L possibly damaging Het
Fbxo28 G T 1: 182,341,421 H51N probably benign Het
Gm12728 T G 4: 105,790,336 probably null Het
Gm973 T C 1: 59,552,461 C335R possibly damaging Het
Gpx8 A G 13: 113,043,236 V177A probably damaging Het
Hdlbp A G 1: 93,412,361 probably null Het
Htt T G 5: 34,877,100 Y1972D probably null Het
Igkv6-14 T C 6: 70,435,132 Y56C possibly damaging Het
Kcnma1 A G 14: 23,526,534 probably null Het
Klc1 T C 12: 111,787,585 S105P probably damaging Het
Klhl20 T C 1: 161,093,696 D63G possibly damaging Het
Lamc3 A G 2: 31,908,689 D469G probably damaging Het
Lrit1 G C 14: 37,060,095 V242L probably damaging Het
Mboat4 G A 8: 34,124,711 R434H probably benign Het
Mttp T C 3: 138,115,282 K270E possibly damaging Het
Muc5ac G A 7: 141,793,298 C337Y possibly damaging Het
Nars A G 18: 64,501,400 V484A probably damaging Het
Noxa1 G T 2: 25,091,832 probably null Het
Olfr297 A G 7: 86,527,314 T186A probably benign Het
Olfr830 T A 9: 18,875,525 L63H probably damaging Het
Osbpl7 G A 11: 97,050,758 G36S probably damaging Het
P4htm C T 9: 108,583,613 G220D probably benign Het
Pcdhga7 A G 18: 37,715,146 I69V probably benign Het
Pla2g4e C T 2: 120,185,314 E250K possibly damaging Het
Plcd4 A G 1: 74,565,835 probably benign Het
Ppfia3 C A 7: 45,358,807 G213V possibly damaging Het
Ppp1r1a A G 15: 103,533,086 S67P probably damaging Het
Prss43 T C 9: 110,828,612 F193S probably benign Het
Rhot1 T A 11: 80,242,095 N218K probably benign Het
Sall1 A G 8: 89,030,393 F1028L probably damaging Het
Siglec1 G A 2: 131,078,077 Q845* probably null Het
Slc38a9 C T 13: 112,701,526 T275I possibly damaging Het
Slc39a4 A T 15: 76,613,270 S481T probably damaging Het
Ssr1 A T 13: 37,986,022 N191K probably damaging Het
Tenm4 A T 7: 96,895,550 S2258C probably damaging Het
Tm7sf3 T G 6: 146,606,147 R472S possibly damaging Het
Tmprss11a G A 5: 86,428,635 T119M probably benign Het
Traip C T 9: 107,961,041 R142* probably null Het
Utrn T C 10: 12,750,470 N100D probably damaging Het
Vmn1r74 T C 7: 11,847,648 S292P probably benign Het
Vmn2r71 A T 7: 85,623,900 I641F probably damaging Het
Vmn2r9 T A 5: 108,849,046 Y119F possibly damaging Het
Vmn2r98 A G 17: 19,065,248 N110S probably damaging Het
Vwce A G 19: 10,664,693 T928A probably benign Het
Zfp608 T A 18: 54,988,265 K83N probably damaging Het
Zfp808 A G 13: 62,173,168 H737R probably benign Het
Zswim4 T C 8: 84,214,085 N795S probably benign Het
Other mutations in Rfx1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01612:Rfx1 APN 8 84092972 critical splice acceptor site probably null
IGL01779:Rfx1 APN 8 84092662 splice site probably benign
IGL02505:Rfx1 APN 8 84095809 missense possibly damaging 0.79
IGL02741:Rfx1 APN 8 84095842 missense possibly damaging 0.94
R1565:Rfx1 UTSW 8 84073946 missense probably benign
R1793:Rfx1 UTSW 8 84066421 unclassified probably benign
R1808:Rfx1 UTSW 8 84095048 missense probably damaging 1.00
R1971:Rfx1 UTSW 8 84095497 missense probably damaging 1.00
R4542:Rfx1 UTSW 8 84090237 missense probably damaging 1.00
R4690:Rfx1 UTSW 8 84082745 missense possibly damaging 0.50
R4995:Rfx1 UTSW 8 84080114 splice site probably null
R5163:Rfx1 UTSW 8 84093211 missense probably damaging 0.98
R5212:Rfx1 UTSW 8 84066592 unclassified probably benign
R5227:Rfx1 UTSW 8 84074058 missense probably damaging 0.99
R5401:Rfx1 UTSW 8 84066376 unclassified probably null
R5431:Rfx1 UTSW 8 84082720 nonsense probably null
R5584:Rfx1 UTSW 8 84088077 splice site probably null
R5693:Rfx1 UTSW 8 84073904 missense unknown
R6210:Rfx1 UTSW 8 84093018 missense probably damaging 1.00
R6715:Rfx1 UTSW 8 84095815 missense possibly damaging 0.49
R7131:Rfx1 UTSW 8 84095079 missense probably damaging 0.96
R7155:Rfx1 UTSW 8 84094826 missense probably damaging 0.99
R7336:Rfx1 UTSW 8 84073756 start gained probably benign
R7467:Rfx1 UTSW 8 84073913 missense possibly damaging 0.86
Z1177:Rfx1 UTSW 8 84090277 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCTTGCAAGAGACACTGGG -3'
(R):5'- CATGCATGGCTACCTTTGTC -3'

Sequencing Primer
(F):5'- CTTGCAAGAGACACTGGGGAAAAC -3'
(R):5'- CCTTTGTCAGGGTCCAAGG -3'
Posted On2018-11-06