Incidental Mutation 'R6920:P4htm'
ID539590
Institutional Source Beutler Lab
Gene Symbol P4htm
Ensembl Gene ENSMUSG00000006675
Gene Nameprolyl 4-hydroxylase, transmembrane (endoplasmic reticulum)
SynonymsP4h-tm, 4933406E20Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.110) question?
Stock #R6920 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location108578862-108597667 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 108583613 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 220 (G220D)
Ref Sequence ENSEMBL: ENSMUSP00000141843 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006853] [ENSMUST00000068700] [ENSMUST00000193621]
Predicted Effect probably benign
Transcript: ENSMUST00000006853
SMART Domains Protein: ENSMUSP00000006853
Gene: ENSMUSG00000006675

DomainStartEndE-ValueType
transmembrane domain 61 83 N/A INTRINSIC
P4Hc 143 460 1.26e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000068700
SMART Domains Protein: ENSMUSP00000070927
Gene: ENSMUSG00000066357

DomainStartEndE-ValueType
Blast:WD40 109 142 3e-6 BLAST
WD40 198 237 1.42e-4 SMART
WD40 247 284 7.28e-2 SMART
WD40 286 326 1.72e-3 SMART
Blast:WD40 336 375 3e-13 BLAST
WD40 479 519 2.96e1 SMART
low complexity region 537 552 N/A INTRINSIC
WD40 559 598 1.77e2 SMART
Blast:WD40 600 641 7e-20 BLAST
Blast:WD40 764 815 2e-22 BLAST
Blast:WD40 855 896 2e-11 BLAST
WD40 900 949 1.48e1 SMART
WD40 973 1015 5.52e-2 SMART
WD40 1035 1076 3.98e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000192080
Predicted Effect probably benign
Transcript: ENSMUST00000193621
AA Change: G220D

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000141843
Gene: ENSMUSG00000006675
AA Change: G220D

DomainStartEndE-ValueType
transmembrane domain 61 83 N/A INTRINSIC
Blast:P4Hc 143 211 5e-39 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.1%
  • 20x: 97.2%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene belongs to the family of prolyl 4-hydroxylases. This protein is a prolyl hydroxylase that may be involved in the degradation of hypoxia-inducible transcription factors under normoxia. It plays a role in adaptation to hypoxia and may be related to cellular oxygen sensing. Alternatively spliced variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit decreased body weight, normal erythropoiesis, and cardioprotection after ischemia-reperfusion injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A T 3: 138,068,050 Y1000F probably damaging Het
1700018B08Rik A G 8: 121,535,421 probably null Het
Aadat T C 8: 60,529,433 F245L probably damaging Het
Adcy10 T G 1: 165,575,658 L1575W probably damaging Het
Anks4b A T 7: 120,183,008 T421S probably damaging Het
Anpep A T 7: 79,825,349 I155N probably damaging Het
Arnt T C 3: 95,490,621 F572L probably damaging Het
Brip1 G A 11: 86,148,536 Q391* probably null Het
Brpf3 C A 17: 28,823,996 H1004N probably benign Het
Cand2 T A 6: 115,791,289 V465D possibly damaging Het
Card10 G T 15: 78,802,409 Y69* probably null Het
Catsperd A T 17: 56,655,175 K450* probably null Het
Ccdc137 T C 11: 120,460,183 L137P probably damaging Het
Cic T C 7: 25,290,682 S1905P probably damaging Het
Csmd3 C T 15: 47,644,205 G2971S probably damaging Het
Dmxl2 A G 9: 54,472,212 Y183H probably damaging Het
Drosha T C 15: 12,834,310 Y167H unknown Het
E330034G19Rik A G 14: 24,308,242 K214R unknown Het
Fam180a T G 6: 35,313,830 I73L possibly damaging Het
Fbxo28 G T 1: 182,341,421 H51N probably benign Het
Gm12728 T G 4: 105,790,336 probably null Het
Gm973 T C 1: 59,552,461 C335R possibly damaging Het
Gpx8 A G 13: 113,043,236 V177A probably damaging Het
Hdlbp A G 1: 93,412,361 probably null Het
Htt T G 5: 34,877,100 Y1972D probably null Het
Igkv6-14 T C 6: 70,435,132 Y56C possibly damaging Het
Kcnma1 A G 14: 23,526,534 probably null Het
Klc1 T C 12: 111,787,585 S105P probably damaging Het
Klhl20 T C 1: 161,093,696 D63G possibly damaging Het
Lamc3 A G 2: 31,908,689 D469G probably damaging Het
Lrit1 G C 14: 37,060,095 V242L probably damaging Het
Mboat4 G A 8: 34,124,711 R434H probably benign Het
Mttp T C 3: 138,115,282 K270E possibly damaging Het
Muc5ac G A 7: 141,793,298 C337Y possibly damaging Het
Nars A G 18: 64,501,400 V484A probably damaging Het
Noxa1 G T 2: 25,091,832 probably null Het
Olfr297 A G 7: 86,527,314 T186A probably benign Het
Olfr830 T A 9: 18,875,525 L63H probably damaging Het
Osbpl7 G A 11: 97,050,758 G36S probably damaging Het
Pcdhga7 A G 18: 37,715,146 I69V probably benign Het
Pla2g4e C T 2: 120,185,314 E250K possibly damaging Het
Plcd4 A G 1: 74,565,835 probably benign Het
Ppfia3 C A 7: 45,358,807 G213V possibly damaging Het
Ppp1r1a A G 15: 103,533,086 S67P probably damaging Het
Prss43 T C 9: 110,828,612 F193S probably benign Het
Rfx1 A G 8: 84,095,488 Y872C probably damaging Het
Rhot1 T A 11: 80,242,095 N218K probably benign Het
Sall1 A G 8: 89,030,393 F1028L probably damaging Het
Siglec1 G A 2: 131,078,077 Q845* probably null Het
Slc38a9 C T 13: 112,701,526 T275I possibly damaging Het
Slc39a4 A T 15: 76,613,270 S481T probably damaging Het
Ssr1 A T 13: 37,986,022 N191K probably damaging Het
Tenm4 A T 7: 96,895,550 S2258C probably damaging Het
Tm7sf3 T G 6: 146,606,147 R472S possibly damaging Het
Tmprss11a G A 5: 86,428,635 T119M probably benign Het
Traip C T 9: 107,961,041 R142* probably null Het
Utrn T C 10: 12,750,470 N100D probably damaging Het
Vmn1r74 T C 7: 11,847,648 S292P probably benign Het
Vmn2r71 A T 7: 85,623,900 I641F probably damaging Het
Vmn2r9 T A 5: 108,849,046 Y119F possibly damaging Het
Vmn2r98 A G 17: 19,065,248 N110S probably damaging Het
Vwce A G 19: 10,664,693 T928A probably benign Het
Zfp608 T A 18: 54,988,265 K83N probably damaging Het
Zfp808 A G 13: 62,173,168 H737R probably benign Het
Zswim4 T C 8: 84,214,085 N795S probably benign Het
Other mutations in P4htm
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01621:P4htm APN 9 108583736 missense probably damaging 1.00
IGL02205:P4htm APN 9 108581962 missense probably benign 0.08
IGL02756:P4htm APN 9 108579778 missense probably damaging 1.00
IGL02802:P4htm UTSW 9 108582856 missense probably benign 0.00
R0605:P4htm UTSW 9 108583724 missense probably null 0.17
R3922:P4htm UTSW 9 108582895 missense probably benign
R4562:P4htm UTSW 9 108581996 missense probably null 1.00
R4730:P4htm UTSW 9 108579772 missense possibly damaging 0.89
R4900:P4htm UTSW 9 108579228 missense probably damaging 1.00
R5027:P4htm UTSW 9 108579293 missense probably benign 0.16
R5124:P4htm UTSW 9 108581942 missense possibly damaging 0.59
R5633:P4htm UTSW 9 108579723 missense probably damaging 1.00
R5877:P4htm UTSW 9 108583733 missense possibly damaging 0.94
R5927:P4htm UTSW 9 108597383 missense probably damaging 1.00
R6163:P4htm UTSW 9 108581951 missense probably damaging 0.99
R6798:P4htm UTSW 9 108582918 missense possibly damaging 0.83
R6962:P4htm UTSW 9 108579195 missense possibly damaging 0.49
R7066:P4htm UTSW 9 108596963 missense probably damaging 0.98
R7183:P4htm UTSW 9 108581860 missense possibly damaging 0.95
R7376:P4htm UTSW 9 108580792 missense probably damaging 0.98
R7506:P4htm UTSW 9 108583679 missense probably damaging 1.00
R7533:P4htm UTSW 9 108596937 missense probably benign 0.02
R7874:P4htm UTSW 9 108596949 missense probably benign 0.01
R8453:P4htm UTSW 9 108580367 unclassified probably benign
R8705:P4htm UTSW 9 108580041 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACTTGTGATAACAGCCTTCCC -3'
(R):5'- AGGAGTGTCGGCTCATCATC -3'

Sequencing Primer
(F):5'- CAGTAAGGGACTGTCAGA -3'
(R):5'- GGCTCATCATCCACCTGG -3'
Posted On2018-11-06