Incidental Mutation 'R6920:Lrit1'
ID539604
Institutional Source Beutler Lab
Gene Symbol Lrit1
Ensembl Gene ENSMUSG00000041044
Gene Nameleucine-rich repeat, immunoglobulin-like and transmembrane domains 1
SynonymsLrrc21
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.075) question?
Stock #R6920 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location37054830-37064946 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 37060095 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 242 (V242L)
Ref Sequence ENSEMBL: ENSMUSP00000113964 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000120052]
Predicted Effect probably damaging
Transcript: ENSMUST00000120052
AA Change: V242L

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000113964
Gene: ENSMUSG00000041044
AA Change: V242L

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
LRRNT 22 63 1.97e-3 SMART
LRR 82 105 1.03e1 SMART
LRR 106 129 3e1 SMART
LRR 130 152 1.12e1 SMART
LRR_TYP 154 177 4.47e-3 SMART
LRRCT 201 253 2.04e-7 SMART
IGc2 267 336 6.55e-8 SMART
FN3 429 506 2.22e0 SMART
transmembrane domain 531 553 N/A INTRINSIC
low complexity region 581 595 N/A INTRINSIC
low complexity region 597 608 N/A INTRINSIC
Meta Mutation Damage Score 0.1859 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.1%
  • 20x: 97.2%
Validation Efficiency 100% (65/65)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired synaptic communication of cone photoreceptors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A T 3: 138,068,050 Y1000F probably damaging Het
1700018B08Rik A G 8: 121,535,421 probably null Het
Aadat T C 8: 60,529,433 F245L probably damaging Het
Adcy10 T G 1: 165,575,658 L1575W probably damaging Het
Anks4b A T 7: 120,183,008 T421S probably damaging Het
Anpep A T 7: 79,825,349 I155N probably damaging Het
Arnt T C 3: 95,490,621 F572L probably damaging Het
Brip1 G A 11: 86,148,536 Q391* probably null Het
Brpf3 C A 17: 28,823,996 H1004N probably benign Het
Cand2 T A 6: 115,791,289 V465D possibly damaging Het
Card10 G T 15: 78,802,409 Y69* probably null Het
Catsperd A T 17: 56,655,175 K450* probably null Het
Ccdc137 T C 11: 120,460,183 L137P probably damaging Het
Cic T C 7: 25,290,682 S1905P probably damaging Het
Csmd3 C T 15: 47,644,205 G2971S probably damaging Het
Dmxl2 A G 9: 54,472,212 Y183H probably damaging Het
Drosha T C 15: 12,834,310 Y167H unknown Het
E330034G19Rik A G 14: 24,308,242 K214R unknown Het
Fam180a T G 6: 35,313,830 I73L possibly damaging Het
Fbxo28 G T 1: 182,341,421 H51N probably benign Het
Gm12728 T G 4: 105,790,336 probably null Het
Gm973 T C 1: 59,552,461 C335R possibly damaging Het
Gpx8 A G 13: 113,043,236 V177A probably damaging Het
Hdlbp A G 1: 93,412,361 probably null Het
Htt T G 5: 34,877,100 Y1972D probably null Het
Igkv6-14 T C 6: 70,435,132 Y56C possibly damaging Het
Kcnma1 A G 14: 23,526,534 probably null Het
Klc1 T C 12: 111,787,585 S105P probably damaging Het
Klhl20 T C 1: 161,093,696 D63G possibly damaging Het
Lamc3 A G 2: 31,908,689 D469G probably damaging Het
Mboat4 G A 8: 34,124,711 R434H probably benign Het
Mttp T C 3: 138,115,282 K270E possibly damaging Het
Muc5ac G A 7: 141,793,298 C337Y possibly damaging Het
Nars A G 18: 64,501,400 V484A probably damaging Het
Noxa1 G T 2: 25,091,832 probably null Het
Olfr297 A G 7: 86,527,314 T186A probably benign Het
Olfr830 T A 9: 18,875,525 L63H probably damaging Het
Osbpl7 G A 11: 97,050,758 G36S probably damaging Het
P4htm C T 9: 108,583,613 G220D probably benign Het
Pcdhga7 A G 18: 37,715,146 I69V probably benign Het
Pla2g4e C T 2: 120,185,314 E250K possibly damaging Het
Plcd4 A G 1: 74,565,835 probably benign Het
Ppfia3 C A 7: 45,358,807 G213V possibly damaging Het
Ppp1r1a A G 15: 103,533,086 S67P probably damaging Het
Prss43 T C 9: 110,828,612 F193S probably benign Het
Rfx1 A G 8: 84,095,488 Y872C probably damaging Het
Rhot1 T A 11: 80,242,095 N218K probably benign Het
Sall1 A G 8: 89,030,393 F1028L probably damaging Het
Siglec1 G A 2: 131,078,077 Q845* probably null Het
Slc38a9 C T 13: 112,701,526 T275I possibly damaging Het
Slc39a4 A T 15: 76,613,270 S481T probably damaging Het
Ssr1 A T 13: 37,986,022 N191K probably damaging Het
Tenm4 A T 7: 96,895,550 S2258C probably damaging Het
Tm7sf3 T G 6: 146,606,147 R472S possibly damaging Het
Tmprss11a G A 5: 86,428,635 T119M probably benign Het
Traip C T 9: 107,961,041 R142* probably null Het
Utrn T C 10: 12,750,470 N100D probably damaging Het
Vmn1r74 T C 7: 11,847,648 S292P probably benign Het
Vmn2r71 A T 7: 85,623,900 I641F probably damaging Het
Vmn2r9 T A 5: 108,849,046 Y119F possibly damaging Het
Vmn2r98 A G 17: 19,065,248 N110S probably damaging Het
Vwce A G 19: 10,664,693 T928A probably benign Het
Zfp608 T A 18: 54,988,265 K83N probably damaging Het
Zfp808 A G 13: 62,173,168 H737R probably benign Het
Zswim4 T C 8: 84,214,085 N795S probably benign Het
Other mutations in Lrit1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01621:Lrit1 APN 14 37060155 missense probably damaging 0.98
IGL01676:Lrit1 APN 14 37057437 missense probably damaging 1.00
IGL02011:Lrit1 APN 14 37062323 missense probably damaging 1.00
PIT4142001:Lrit1 UTSW 14 37062041 missense probably damaging 1.00
R0194:Lrit1 UTSW 14 37061720 missense probably damaging 1.00
R0348:Lrit1 UTSW 14 37060225 missense probably damaging 1.00
R1444:Lrit1 UTSW 14 37061971 missense probably benign
R1500:Lrit1 UTSW 14 37062134 missense probably benign 0.23
R1884:Lrit1 UTSW 14 37061753 missense possibly damaging 0.94
R2880:Lrit1 UTSW 14 37057437 missense probably damaging 1.00
R4784:Lrit1 UTSW 14 37062236 missense possibly damaging 0.79
R4855:Lrit1 UTSW 14 37061816 missense possibly damaging 0.75
R5100:Lrit1 UTSW 14 37062214 missense possibly damaging 0.74
R5365:Lrit1 UTSW 14 37062142 missense probably benign 0.00
R5474:Lrit1 UTSW 14 37061986 missense probably benign
R5475:Lrit1 UTSW 14 37055001 missense probably benign 0.00
R5614:Lrit1 UTSW 14 37061954 missense probably benign 0.39
R5688:Lrit1 UTSW 14 37062428 missense possibly damaging 0.66
R5926:Lrit1 UTSW 14 37055009 missense probably damaging 1.00
R6063:Lrit1 UTSW 14 37054988 missense probably benign 0.05
R6940:Lrit1 UTSW 14 37060095 missense probably damaging 0.99
R6941:Lrit1 UTSW 14 37060095 missense probably damaging 0.99
R6943:Lrit1 UTSW 14 37060095 missense probably damaging 0.99
R6945:Lrit1 UTSW 14 37060095 missense probably damaging 0.99
R6957:Lrit1 UTSW 14 37060095 missense probably damaging 0.99
R6958:Lrit1 UTSW 14 37060095 missense probably damaging 0.99
R6959:Lrit1 UTSW 14 37060095 missense probably damaging 0.99
R6960:Lrit1 UTSW 14 37060095 missense probably damaging 0.99
R6962:Lrit1 UTSW 14 37060095 missense probably damaging 0.99
R7784:Lrit1 UTSW 14 37061780 missense probably benign
Predicted Primers PCR Primer
(F):5'- TTTCTTCCCAGAGGAGAAATGG -3'
(R):5'- CACTTGGTTGCTCACACACC -3'

Sequencing Primer
(F):5'- CTGGTTCTGAAGATCTGAGGTTAACC -3'
(R):5'- ACACCTGTGCCATTGAGTG -3'
Posted On2018-11-06