Incidental Mutation 'R6920:Drosha'
ID539605
Institutional Source Beutler Lab
Gene Symbol Drosha
Ensembl Gene ENSMUSG00000022191
Gene Namedrosha, ribonuclease type III
Synonyms1110013A17Rik, Rnasen, Etohi2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.959) question?
Stock #R6920 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location12824815-12935291 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 12834310 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 167 (Y167H)
Ref Sequence ENSEMBL: ENSMUSP00000129279 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090292] [ENSMUST00000169061]
Predicted Effect unknown
Transcript: ENSMUST00000090292
AA Change: Y167H
SMART Domains Protein: ENSMUSP00000087762
Gene: ENSMUSG00000022191
AA Change: Y167H

DomainStartEndE-ValueType
low complexity region 13 32 N/A INTRINSIC
low complexity region 43 69 N/A INTRINSIC
low complexity region 72 102 N/A INTRINSIC
low complexity region 109 137 N/A INTRINSIC
low complexity region 142 169 N/A INTRINSIC
low complexity region 185 200 N/A INTRINSIC
low complexity region 227 269 N/A INTRINSIC
low complexity region 273 301 N/A INTRINSIC
low complexity region 357 370 N/A INTRINSIC
low complexity region 387 410 N/A INTRINSIC
low complexity region 472 499 N/A INTRINSIC
SCOP:d1jfza_ 878 902 4e-4 SMART
RIBOc 942 1076 1.73e-45 SMART
Blast:RIBOc 1086 1112 1e-6 BLAST
RIBOc 1121 1253 1.6e-49 SMART
DSRM 1260 1332 5.75e-20 SMART
coiled coil region 1346 1370 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000169061
AA Change: Y167H
SMART Domains Protein: ENSMUSP00000129279
Gene: ENSMUSG00000022191
AA Change: Y167H

DomainStartEndE-ValueType
low complexity region 13 32 N/A INTRINSIC
low complexity region 43 69 N/A INTRINSIC
low complexity region 72 102 N/A INTRINSIC
low complexity region 109 137 N/A INTRINSIC
low complexity region 142 169 N/A INTRINSIC
low complexity region 185 200 N/A INTRINSIC
low complexity region 227 269 N/A INTRINSIC
low complexity region 273 301 N/A INTRINSIC
low complexity region 357 370 N/A INTRINSIC
low complexity region 387 410 N/A INTRINSIC
low complexity region 472 499 N/A INTRINSIC
SCOP:d1jfza_ 878 902 4e-4 SMART
RIBOc 942 1076 1.73e-45 SMART
Blast:RIBOc 1086 1112 1e-6 BLAST
RIBOc 1121 1253 1.6e-49 SMART
DSRM 1260 1332 5.75e-20 SMART
coiled coil region 1346 1370 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.1%
  • 20x: 97.2%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a ribonuclease (RNase) III double-stranded RNA-specific ribonuclease and subunit of the microprocessor protein complex, which catalyzes the initial processing step of microRNA (miRNA) synthesis. The encoded protein cleaves the stem loop structure from the primary microRNA (pri-miRNA) in the nucleus, yielding the precursor miRNA (pre-miRNA), which is then exported to the cytoplasm for further processing. In a human cell line lacking a functional copy of this gene, canonical miRNA synthesis is reduced. Somatic mutations in this gene have been observed in human patients with kidney cancer. [provided by RefSeq, Sep 2016]
PHENOTYPE: Mice heterozygous for a knock-out allele and a conditional allele activated in the immune system exhibit increased inflammation in multiple systems, cachexia and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A T 3: 138,068,050 Y1000F probably damaging Het
1700018B08Rik A G 8: 121,535,421 probably null Het
Aadat T C 8: 60,529,433 F245L probably damaging Het
Adcy10 T G 1: 165,575,658 L1575W probably damaging Het
Anks4b A T 7: 120,183,008 T421S probably damaging Het
Anpep A T 7: 79,825,349 I155N probably damaging Het
Arnt T C 3: 95,490,621 F572L probably damaging Het
Brip1 G A 11: 86,148,536 Q391* probably null Het
Brpf3 C A 17: 28,823,996 H1004N probably benign Het
Cand2 T A 6: 115,791,289 V465D possibly damaging Het
Card10 G T 15: 78,802,409 Y69* probably null Het
Catsperd A T 17: 56,655,175 K450* probably null Het
Ccdc137 T C 11: 120,460,183 L137P probably damaging Het
Cic T C 7: 25,290,682 S1905P probably damaging Het
Csmd3 C T 15: 47,644,205 G2971S probably damaging Het
Dmxl2 A G 9: 54,472,212 Y183H probably damaging Het
E330034G19Rik A G 14: 24,308,242 K214R unknown Het
Fam180a T G 6: 35,313,830 I73L possibly damaging Het
Fbxo28 G T 1: 182,341,421 H51N probably benign Het
Gm12728 T G 4: 105,790,336 probably null Het
Gm973 T C 1: 59,552,461 C335R possibly damaging Het
Gpx8 A G 13: 113,043,236 V177A probably damaging Het
Hdlbp A G 1: 93,412,361 probably null Het
Htt T G 5: 34,877,100 Y1972D probably null Het
Igkv6-14 T C 6: 70,435,132 Y56C possibly damaging Het
Kcnma1 A G 14: 23,526,534 probably null Het
Klc1 T C 12: 111,787,585 S105P probably damaging Het
Klhl20 T C 1: 161,093,696 D63G possibly damaging Het
Lamc3 A G 2: 31,908,689 D469G probably damaging Het
Lrit1 G C 14: 37,060,095 V242L probably damaging Het
Mboat4 G A 8: 34,124,711 R434H probably benign Het
Mttp T C 3: 138,115,282 K270E possibly damaging Het
Muc5ac G A 7: 141,793,298 C337Y possibly damaging Het
Nars A G 18: 64,501,400 V484A probably damaging Het
Noxa1 G T 2: 25,091,832 probably null Het
Olfr297 A G 7: 86,527,314 T186A probably benign Het
Olfr830 T A 9: 18,875,525 L63H probably damaging Het
Osbpl7 G A 11: 97,050,758 G36S probably damaging Het
P4htm C T 9: 108,583,613 G220D probably benign Het
Pcdhga7 A G 18: 37,715,146 I69V probably benign Het
Pla2g4e C T 2: 120,185,314 E250K possibly damaging Het
Plcd4 A G 1: 74,565,835 probably benign Het
Ppfia3 C A 7: 45,358,807 G213V possibly damaging Het
Ppp1r1a A G 15: 103,533,086 S67P probably damaging Het
Prss43 T C 9: 110,828,612 F193S probably benign Het
Rfx1 A G 8: 84,095,488 Y872C probably damaging Het
Rhot1 T A 11: 80,242,095 N218K probably benign Het
Sall1 A G 8: 89,030,393 F1028L probably damaging Het
Siglec1 G A 2: 131,078,077 Q845* probably null Het
Slc38a9 C T 13: 112,701,526 T275I possibly damaging Het
Slc39a4 A T 15: 76,613,270 S481T probably damaging Het
Ssr1 A T 13: 37,986,022 N191K probably damaging Het
Tenm4 A T 7: 96,895,550 S2258C probably damaging Het
Tm7sf3 T G 6: 146,606,147 R472S possibly damaging Het
Tmprss11a G A 5: 86,428,635 T119M probably benign Het
Traip C T 9: 107,961,041 R142* probably null Het
Utrn T C 10: 12,750,470 N100D probably damaging Het
Vmn1r74 T C 7: 11,847,648 S292P probably benign Het
Vmn2r71 A T 7: 85,623,900 I641F probably damaging Het
Vmn2r9 T A 5: 108,849,046 Y119F possibly damaging Het
Vmn2r98 A G 17: 19,065,248 N110S probably damaging Het
Vwce A G 19: 10,664,693 T928A probably benign Het
Zfp608 T A 18: 54,988,265 K83N probably damaging Het
Zfp808 A G 13: 62,173,168 H737R probably benign Het
Zswim4 T C 8: 84,214,085 N795S probably benign Het
Other mutations in Drosha
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00576:Drosha APN 15 12883194 missense probably damaging 0.99
IGL00736:Drosha APN 15 12833959 missense unknown
IGL00963:Drosha APN 15 12925997 missense probably damaging 0.99
IGL01010:Drosha APN 15 12827289 unclassified probably benign
IGL01340:Drosha APN 15 12834023 intron probably benign
IGL01481:Drosha APN 15 12842439 missense probably benign
IGL01714:Drosha APN 15 12878784 missense probably damaging 1.00
IGL01721:Drosha APN 15 12846112 nonsense probably null
IGL01765:Drosha APN 15 12902680 missense probably damaging 1.00
IGL01893:Drosha APN 15 12866650 splice site probably benign
IGL01944:Drosha APN 15 12889719 missense probably damaging 1.00
IGL02285:Drosha APN 15 12833864 missense unknown
IGL02970:Drosha APN 15 12913956 missense probably damaging 0.98
IGL02990:Drosha APN 15 12827267 unclassified probably benign
IGL03019:Drosha APN 15 12846099 missense probably damaging 1.00
IGL03279:Drosha APN 15 12859392 missense probably benign 0.03
IGL03390:Drosha APN 15 12884983 splice site probably null
tippicanoe UTSW 15 12859465 splice site probably null
Tyler UTSW 15 12861706 missense probably benign 0.45
R0115:Drosha UTSW 15 12846130 missense probably benign 0.15
R0352:Drosha UTSW 15 12837288 missense unknown
R0401:Drosha UTSW 15 12926031 nonsense probably null
R0541:Drosha UTSW 15 12907388 missense probably benign 0.09
R0784:Drosha UTSW 15 12867678 splice site probably benign
R0918:Drosha UTSW 15 12842533 critical splice donor site probably null
R1473:Drosha UTSW 15 12912520 missense probably benign 0.04
R1503:Drosha UTSW 15 12848073 missense probably benign 0.02
R1526:Drosha UTSW 15 12913984 missense probably damaging 1.00
R1809:Drosha UTSW 15 12890112 missense probably null 1.00
R1859:Drosha UTSW 15 12878718 missense probably benign 0.14
R2004:Drosha UTSW 15 12915381 missense probably damaging 0.98
R2060:Drosha UTSW 15 12924159 missense possibly damaging 0.94
R2516:Drosha UTSW 15 12859465 splice site probably null
R3691:Drosha UTSW 15 12834638 missense unknown
R3784:Drosha UTSW 15 12890529 missense possibly damaging 0.82
R3789:Drosha UTSW 15 12912537 nonsense probably null
R3790:Drosha UTSW 15 12912537 nonsense probably null
R4020:Drosha UTSW 15 12837336 missense possibly damaging 0.96
R4817:Drosha UTSW 15 12914047 missense probably damaging 0.97
R4989:Drosha UTSW 15 12935007 missense probably benign 0.05
R5080:Drosha UTSW 15 12842143 missense probably benign 0.01
R5132:Drosha UTSW 15 12837291 missense unknown
R5215:Drosha UTSW 15 12885133 intron probably benign
R5386:Drosha UTSW 15 12842121 missense probably benign
R5457:Drosha UTSW 15 12926029 missense probably benign 0.26
R5536:Drosha UTSW 15 12929711 missense possibly damaging 0.58
R5800:Drosha UTSW 15 12865067 missense probably damaging 1.00
R5800:Drosha UTSW 15 12902647 missense probably damaging 1.00
R5915:Drosha UTSW 15 12935066 missense probably damaging 0.97
R5988:Drosha UTSW 15 12834496 intron probably benign
R6033:Drosha UTSW 15 12925999 missense probably benign 0.25
R6033:Drosha UTSW 15 12925999 missense probably benign 0.25
R6063:Drosha UTSW 15 12834070 intron probably benign
R6391:Drosha UTSW 15 12889717 nonsense probably null
R6492:Drosha UTSW 15 12861706 missense probably benign 0.45
R6799:Drosha UTSW 15 12912537 nonsense probably null
R6870:Drosha UTSW 15 12907393 missense probably benign 0.17
R7101:Drosha UTSW 15 12865067 missense probably damaging 1.00
R7142:Drosha UTSW 15 12924146 missense possibly damaging 0.70
R7275:Drosha UTSW 15 12846083 missense possibly damaging 0.73
R7337:Drosha UTSW 15 12846199 missense possibly damaging 0.80
R7471:Drosha UTSW 15 12889656 missense probably damaging 1.00
R7538:Drosha UTSW 15 12926243 missense probably damaging 1.00
R7559:Drosha UTSW 15 12842422 missense probably damaging 0.96
R7651:Drosha UTSW 15 12859436 missense probably benign 0.30
R7652:Drosha UTSW 15 12859436 missense probably benign 0.30
R7653:Drosha UTSW 15 12859436 missense probably benign 0.30
R7727:Drosha UTSW 15 12881645 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGATGAGACACCCTTTCCCG -3'
(R):5'- CAGGTCTTCTCCTTTCAGGG -3'

Sequencing Primer
(F):5'- GGTGCCTCCCTGTTTTCCAC -3'
(R):5'- TCGCCCGTGACTGTGATC -3'
Posted On2018-11-06