Mutagenetix > Incidental Mutation

Incidental Mutation 'R6920:Brpf3'

539611

Institutional Source

Beutler Lab

Gene Symbol

Brpf3

Ensembl Gene

ENSMUSG00000063952

Gene Name

bromodomain and PHD finger containing, 3

Synonyms

MMRRC Submission

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.467) question?

Stock #

R6920 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

28801090-28838546 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 28823996 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Asparagine at position 1004 (H1004N)

Ref Sequence

ENSEMBL: ENSMUSP00000004985 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000004985]

AlphaFold

B2KF05

Predicted Effect

probably benign
Transcript: ENSMUST00000004985
AA Change: H1004N

PolyPhen 2 Score 0.336 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000004985
Gene: ENSMUSG00000063952
AA Change: H1004N

Domain	Start	End	E-Value	Type
Pfam:EPL1	48	194	8.4e-38	PFAM
PHD	214	260	7.07e-5	SMART
PHD	324	387	4.74e-6	SMART
low complexity region	405	436	N/A	INTRINSIC
Blast:BROMO	491	534	7e-21	BLAST
low complexity region	558	577	N/A	INTRINSIC
BROMO	586	694	4.93e-39	SMART
low complexity region	777	792	N/A	INTRINSIC
low complexity region	813	823	N/A	INTRINSIC
PWWP	1073	1156	2.07e-38	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.1%
20x: 97.2%

Validation Efficiency

100% (65/65)

MGI Phenotype

PHENOTYPE: Homozygous knockout does not result in any obvious neurological, behavioral, developmental, histological, hematological, survival or reproductive phenotype. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110002E22Rik	A	T	3: 138,068,050	Y1000F	probably damaging	Het
1700018B08Rik	A	G	8: 121,535,421		probably null	Het
Aadat	T	C	8: 60,529,433	F245L	probably damaging	Het
Adcy10	T	G	1: 165,575,658	L1575W	probably damaging	Het
Anks4b	A	T	7: 120,183,008	T421S	probably damaging	Het
Anpep	A	T	7: 79,825,349	I155N	probably damaging	Het
Arnt	T	C	3: 95,490,621	F572L	probably damaging	Het
Brip1	G	A	11: 86,148,536	Q391*	probably null	Het
Cand2	T	A	6: 115,791,289	V465D	possibly damaging	Het
Card10	G	T	15: 78,802,409	Y69*	probably null	Het
Catsperd	A	T	17: 56,655,175	K450*	probably null	Het
Ccdc137	T	C	11: 120,460,183	L137P	probably damaging	Het
Cic	T	C	7: 25,290,682	S1905P	probably damaging	Het
Csmd3	C	T	15: 47,644,205	G2971S	probably damaging	Het
Dmxl2	A	G	9: 54,472,212	Y183H	probably damaging	Het
Drosha	T	C	15: 12,834,310	Y167H	unknown	Het
E330034G19Rik	A	G	14: 24,308,242	K214R	unknown	Het
Fam180a	T	G	6: 35,313,830	I73L	possibly damaging	Het
Fbxo28	G	T	1: 182,341,421	H51N	probably benign	Het
Gm12728	T	G	4: 105,790,336		probably null	Het
Gm973	T	C	1: 59,552,461	C335R	possibly damaging	Het
Gpx8	A	G	13: 113,043,236	V177A	probably damaging	Het
Hdlbp	A	G	1: 93,412,361		probably null	Het
Htt	T	G	5: 34,877,100	Y1972D	probably null	Het
Igkv6-14	T	C	6: 70,435,132	Y56C	possibly damaging	Het
Kcnma1	A	G	14: 23,526,534		probably null	Het
Klc1	T	C	12: 111,787,585	S105P	probably damaging	Het
Klhl20	T	C	1: 161,093,696	D63G	possibly damaging	Het
Lamc3	A	G	2: 31,908,689	D469G	probably damaging	Het
Lrit1	G	C	14: 37,060,095	V242L	probably damaging	Het
Mboat4	G	A	8: 34,124,711	R434H	probably benign	Het
Mttp	T	C	3: 138,115,282	K270E	possibly damaging	Het
Muc5ac	G	A	7: 141,793,298	C337Y	possibly damaging	Het
Nars	A	G	18: 64,501,400	V484A	probably damaging	Het
Noxa1	G	T	2: 25,091,832		probably null	Het
Olfr297	A	G	7: 86,527,314	T186A	probably benign	Het
Olfr830	T	A	9: 18,875,525	L63H	probably damaging	Het
Osbpl7	G	A	11: 97,050,758	G36S	probably damaging	Het
P4htm	C	T	9: 108,583,613	G220D	probably benign	Het
Pcdhga7	A	G	18: 37,715,146	I69V	probably benign	Het
Pla2g4e	C	T	2: 120,185,314	E250K	possibly damaging	Het
Plcd4	A	G	1: 74,565,835		probably benign	Het
Ppfia3	C	A	7: 45,358,807	G213V	possibly damaging	Het
Ppp1r1a	A	G	15: 103,533,086	S67P	probably damaging	Het
Prss43	T	C	9: 110,828,612	F193S	probably benign	Het
Rfx1	A	G	8: 84,095,488	Y872C	probably damaging	Het
Rhot1	T	A	11: 80,242,095	N218K	probably benign	Het
Sall1	A	G	8: 89,030,393	F1028L	probably damaging	Het
Siglec1	G	A	2: 131,078,077	Q845*	probably null	Het
Slc38a9	C	T	13: 112,701,526	T275I	possibly damaging	Het
Slc39a4	A	T	15: 76,613,270	S481T	probably damaging	Het
Ssr1	A	T	13: 37,986,022	N191K	probably damaging	Het
Tenm4	A	T	7: 96,895,550	S2258C	probably damaging	Het
Tm7sf3	T	G	6: 146,606,147	R472S	possibly damaging	Het
Tmprss11a	G	A	5: 86,428,635	T119M	probably benign	Het
Traip	C	T	9: 107,961,041	R142*	probably null	Het
Utrn	T	C	10: 12,750,470	N100D	probably damaging	Het
Vmn1r74	T	C	7: 11,847,648	S292P	probably benign	Het
Vmn2r71	A	T	7: 85,623,900	I641F	probably damaging	Het
Vmn2r9	T	A	5: 108,849,046	Y119F	possibly damaging	Het
Vmn2r98	A	G	17: 19,065,248	N110S	probably damaging	Het
Vwce	A	G	19: 10,664,693	T928A	probably benign	Het
Zfp608	T	A	18: 54,988,265	K83N	probably damaging	Het
Zfp808	A	G	13: 62,173,168	H737R	probably benign	Het
Zswim4	T	C	8: 84,214,085	N795S	probably benign	Het

Other mutations in Brpf3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00906:Brpf3	APN	17	28836700	utr 3 prime	probably benign
IGL01397:Brpf3	APN	17	28817632	missense	probably benign	0.22
IGL01608:Brpf3	APN	17	28821517	missense	probably benign	0.00
IGL02073:Brpf3	APN	17	28807396	missense	probably benign
IGL02540:Brpf3	APN	17	28828354	missense	probably damaging	1.00
IGL02838:Brpf3	APN	17	28835784	missense	probably benign	0.19
IGL02888:Brpf3	APN	17	28828391	missense	probably damaging	1.00
IGL02969:Brpf3	APN	17	28821305	missense	probably benign	0.05
IGL03036:Brpf3	APN	17	28824048	missense	possibly damaging	0.89
IGL03084:Brpf3	APN	17	28835777	missense	probably damaging	0.98
R0448:Brpf3	UTSW	17	28806036	missense	probably benign	0.10
R0898:Brpf3	UTSW	17	28806990	missense	possibly damaging	0.65
R1268:Brpf3	UTSW	17	28836556	missense	probably damaging	0.98
R1639:Brpf3	UTSW	17	28824068	critical splice donor site	probably null
R1754:Brpf3	UTSW	17	28821323	missense	probably benign	0.00
R1867:Brpf3	UTSW	17	28807368	missense	probably benign
R1954:Brpf3	UTSW	17	28806559	missense	probably benign
R2000:Brpf3	UTSW	17	28821557	missense	probably benign	0.20
R2064:Brpf3	UTSW	17	28821364	missense	probably benign
R2209:Brpf3	UTSW	17	28828420	missense	probably damaging	0.98
R2413:Brpf3	UTSW	17	28805950	start gained	probably benign
R3977:Brpf3	UTSW	17	28807042	missense	possibly damaging	0.49
R4067:Brpf3	UTSW	17	28821259	missense	probably benign
R4291:Brpf3	UTSW	17	28823975	missense	probably benign	0.00
R4369:Brpf3	UTSW	17	28836620	missense	probably damaging	1.00
R4371:Brpf3	UTSW	17	28836620	missense	probably damaging	1.00
R4741:Brpf3	UTSW	17	28817784	missense	possibly damaging	0.50
R4773:Brpf3	UTSW	17	28821259	missense	probably benign	0.00
R4824:Brpf3	UTSW	17	28806486	missense	probably benign
R5360:Brpf3	UTSW	17	28810562	missense	probably benign
R5923:Brpf3	UTSW	17	28806636	missense	possibly damaging	0.90
R6181:Brpf3	UTSW	17	28810581	missense	probably damaging	1.00
R6278:Brpf3	UTSW	17	28821284	missense	probably benign	0.00
R6702:Brpf3	UTSW	17	28810659	missense	probably benign	0.01
R6884:Brpf3	UTSW	17	28831350	missense	probably benign	0.03
R6976:Brpf3	UTSW	17	28835777	missense	probably damaging	0.98
R7099:Brpf3	UTSW	17	28806637	missense	probably benign	0.06
R7108:Brpf3	UTSW	17	28817125	missense	probably benign	0.01
R7193:Brpf3	UTSW	17	28836691	makesense	probably null
R7316:Brpf3	UTSW	17	28814686	missense	probably damaging	1.00
R7326:Brpf3	UTSW	17	28806293	missense	probably benign	0.00
R7403:Brpf3	UTSW	17	28821356	missense	probably benign
R7666:Brpf3	UTSW	17	28810572	missense	possibly damaging	0.83
R7686:Brpf3	UTSW	17	28806934	missense	probably damaging	0.98
R7691:Brpf3	UTSW	17	28806831	missense	probably damaging	1.00
R8054:Brpf3	UTSW	17	28836597	missense	probably damaging	1.00
R8165:Brpf3	UTSW	17	28806274	missense	probably benign	0.01
R8200:Brpf3	UTSW	17	28806274	missense	probably benign	0.01
R8698:Brpf3	UTSW	17	28818462	missense	probably damaging	0.99
R8722:Brpf3	UTSW	17	28810536	missense	probably benign	0.42
R8738:Brpf3	UTSW	17	28821240	missense	probably benign
R9044:Brpf3	UTSW	17	28806897	missense	possibly damaging	0.90
R9250:Brpf3	UTSW	17	28835814	missense	probably damaging	1.00
R9349:Brpf3	UTSW	17	28821302	missense	probably benign	0.00
R9496:Brpf3	UTSW	17	28821479	missense	probably benign
R9564:Brpf3	UTSW	17	28807178	missense	probably benign
R9649:Brpf3	UTSW	17	28818623	missense	probably benign
R9720:Brpf3	UTSW	17	28807356	missense	probably benign	0.13
Z1177:Brpf3	UTSW	17	28821478	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- GTCTCTGTGAGAGTCCTTCTGC -3'
(R):5'- GATCTGAGAAATCAAGGGCCAATC -3'

Sequencing Primer
(F):5'- GAGAGTCCTTCTGCCACCTGTG -3'
(R):5'- AATCCCTTTCCCTCGGGG -3'

Posted On

2018-11-06