Incidental Mutation 'R6920:Catsperd'
ID539612
Institutional Source Beutler Lab
Gene Symbol Catsperd
Ensembl Gene ENSMUSG00000040828
Gene Namecation channel sperm associated auxiliary subunit delta
Synonyms4933402B14Rik, 4921529N20Rik, Gm6095, Tmem146
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock #R6920 (G1)
Quality Score174.009
Status Validated
Chromosome17
Chromosomal Location56628143-56664456 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 56655175 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 450 (K450*)
Ref Sequence ENSEMBL: ENSMUSP00000108603 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112979]
Predicted Effect probably null
Transcript: ENSMUST00000112979
AA Change: K450*
SMART Domains Protein: ENSMUSP00000108603
Gene: ENSMUSG00000040828
AA Change: K450*

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Pfam:CATSPERD 38 766 N/A PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.1%
  • 20x: 97.2%
Validation Efficiency 100% (65/65)
MGI Phenotype PHENOTYPE: Mice homozygous for a deletion in this gene display male infertility. Hyperactivity of sperm fails to develop under capacitating conditions. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A T 3: 138,068,050 Y1000F probably damaging Het
1700018B08Rik A G 8: 121,535,421 probably null Het
Aadat T C 8: 60,529,433 F245L probably damaging Het
Adcy10 T G 1: 165,575,658 L1575W probably damaging Het
Anks4b A T 7: 120,183,008 T421S probably damaging Het
Anpep A T 7: 79,825,349 I155N probably damaging Het
Arnt T C 3: 95,490,621 F572L probably damaging Het
Brip1 G A 11: 86,148,536 Q391* probably null Het
Brpf3 C A 17: 28,823,996 H1004N probably benign Het
Cand2 T A 6: 115,791,289 V465D possibly damaging Het
Card10 G T 15: 78,802,409 Y69* probably null Het
Ccdc137 T C 11: 120,460,183 L137P probably damaging Het
Cic T C 7: 25,290,682 S1905P probably damaging Het
Csmd3 C T 15: 47,644,205 G2971S probably damaging Het
Dmxl2 A G 9: 54,472,212 Y183H probably damaging Het
Drosha T C 15: 12,834,310 Y167H unknown Het
E330034G19Rik A G 14: 24,308,242 K214R unknown Het
Fam180a T G 6: 35,313,830 I73L possibly damaging Het
Fbxo28 G T 1: 182,341,421 H51N probably benign Het
Gm12728 T G 4: 105,790,336 probably null Het
Gm973 T C 1: 59,552,461 C335R possibly damaging Het
Gpx8 A G 13: 113,043,236 V177A probably damaging Het
Hdlbp A G 1: 93,412,361 probably null Het
Htt T G 5: 34,877,100 Y1972D probably null Het
Igkv6-14 T C 6: 70,435,132 Y56C possibly damaging Het
Kcnma1 A G 14: 23,526,534 probably null Het
Klc1 T C 12: 111,787,585 S105P probably damaging Het
Klhl20 T C 1: 161,093,696 D63G possibly damaging Het
Lamc3 A G 2: 31,908,689 D469G probably damaging Het
Lrit1 G C 14: 37,060,095 V242L probably damaging Het
Mboat4 G A 8: 34,124,711 R434H probably benign Het
Mttp T C 3: 138,115,282 K270E possibly damaging Het
Muc5ac G A 7: 141,793,298 C337Y possibly damaging Het
Nars A G 18: 64,501,400 V484A probably damaging Het
Noxa1 G T 2: 25,091,832 probably null Het
Olfr297 A G 7: 86,527,314 T186A probably benign Het
Olfr830 T A 9: 18,875,525 L63H probably damaging Het
Osbpl7 G A 11: 97,050,758 G36S probably damaging Het
P4htm C T 9: 108,583,613 G220D probably benign Het
Pcdhga7 A G 18: 37,715,146 I69V probably benign Het
Pla2g4e C T 2: 120,185,314 E250K possibly damaging Het
Plcd4 A G 1: 74,565,835 probably benign Het
Ppfia3 C A 7: 45,358,807 G213V possibly damaging Het
Ppp1r1a A G 15: 103,533,086 S67P probably damaging Het
Prss43 T C 9: 110,828,612 F193S probably benign Het
Rfx1 A G 8: 84,095,488 Y872C probably damaging Het
Rhot1 T A 11: 80,242,095 N218K probably benign Het
Sall1 A G 8: 89,030,393 F1028L probably damaging Het
Siglec1 G A 2: 131,078,077 Q845* probably null Het
Slc38a9 C T 13: 112,701,526 T275I possibly damaging Het
Slc39a4 A T 15: 76,613,270 S481T probably damaging Het
Ssr1 A T 13: 37,986,022 N191K probably damaging Het
Tenm4 A T 7: 96,895,550 S2258C probably damaging Het
Tm7sf3 T G 6: 146,606,147 R472S possibly damaging Het
Tmprss11a G A 5: 86,428,635 T119M probably benign Het
Traip C T 9: 107,961,041 R142* probably null Het
Utrn T C 10: 12,750,470 N100D probably damaging Het
Vmn1r74 T C 7: 11,847,648 S292P probably benign Het
Vmn2r71 A T 7: 85,623,900 I641F probably damaging Het
Vmn2r9 T A 5: 108,849,046 Y119F possibly damaging Het
Vmn2r98 A G 17: 19,065,248 N110S probably damaging Het
Vwce A G 19: 10,664,693 T928A probably benign Het
Zfp608 T A 18: 54,988,265 K83N probably damaging Het
Zfp808 A G 13: 62,173,168 H737R probably benign Het
Zswim4 T C 8: 84,214,085 N795S probably benign Het
Other mutations in Catsperd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02514:Catsperd APN 17 56661271 missense probably damaging 0.98
IGL02598:Catsperd APN 17 56647815 splice site probably null
IGL03037:Catsperd APN 17 56641583 missense possibly damaging 0.80
IGL03330:Catsperd APN 17 56632316 missense possibly damaging 0.45
R0391:Catsperd UTSW 17 56662821 missense probably benign 0.00
R0463:Catsperd UTSW 17 56659554 missense probably damaging 0.99
R0506:Catsperd UTSW 17 56658078 missense possibly damaging 0.95
R0538:Catsperd UTSW 17 56662828 missense probably benign 0.00
R0550:Catsperd UTSW 17 56663427 critical splice donor site probably null
R1503:Catsperd UTSW 17 56654525 missense possibly damaging 0.63
R1705:Catsperd UTSW 17 56633521 missense probably damaging 0.97
R1919:Catsperd UTSW 17 56635548 missense probably damaging 0.99
R2851:Catsperd UTSW 17 56660169 critical splice acceptor site probably null
R2852:Catsperd UTSW 17 56660169 critical splice acceptor site probably null
R3147:Catsperd UTSW 17 56664039 missense possibly damaging 0.86
R3148:Catsperd UTSW 17 56664039 missense possibly damaging 0.86
R4084:Catsperd UTSW 17 56654453 missense probably benign 0.14
R4329:Catsperd UTSW 17 56654517 missense possibly damaging 0.80
R4940:Catsperd UTSW 17 56662736 missense possibly damaging 0.95
R4944:Catsperd UTSW 17 56662744 missense probably damaging 0.97
R4952:Catsperd UTSW 17 56632303 missense probably damaging 0.99
R5079:Catsperd UTSW 17 56658153 critical splice donor site probably null
R5259:Catsperd UTSW 17 56660235 missense possibly damaging 0.93
R5635:Catsperd UTSW 17 56632335 missense possibly damaging 0.95
R5929:Catsperd UTSW 17 56652493 missense probably benign 0.00
R6789:Catsperd UTSW 17 56654426 splice site probably null
R6909:Catsperd UTSW 17 56650781 missense probably damaging 0.96
R7099:Catsperd UTSW 17 56628811 splice site probably null
R7106:Catsperd UTSW 17 56658070 splice site probably null
R7371:Catsperd UTSW 17 56650801 missense probably benign 0.22
R7405:Catsperd UTSW 17 56632335 missense possibly damaging 0.95
R7478:Catsperd UTSW 17 56664055 missense probably benign 0.00
R7781:Catsperd UTSW 17 56664072 missense probably benign 0.00
R7918:Catsperd UTSW 17 56631564 missense probably benign 0.06
R7981:Catsperd UTSW 17 56631562 missense possibly damaging 0.85
R8200:Catsperd UTSW 17 56632368 critical splice donor site probably null
R8487:Catsperd UTSW 17 56663419 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTGTGTGCAGAACTGGCTTC -3'
(R):5'- TTTTCAGAGTGCACAGCATTG -3'

Sequencing Primer
(F):5'- CTGTTTGCTGAGGGTACACAG -3'
(R):5'- ACTATCCAGTCCTTGAGAGGTCAG -3'
Posted On2018-11-06