Mutagenetix > Incidental Mutation

Incidental Mutation 'R6920:Nars'

539615

Institutional Source

Beutler Lab

Gene Symbol

Nars

Ensembl Gene

ENSMUSG00000024587

Gene Name

asparaginyl-tRNA synthetase

Synonyms

ASNRS

MMRRC Submission

Accession Numbers

Essential gene?

Probably essential (E-score: 0.968) question?

Stock #

R6920 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

64499665-64516557 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 64501400 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 484 (V484A)

Ref Sequence

ENSEMBL: ENSMUSP00000025483 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000025483]

AlphaFold

Q8BP47

Predicted Effect

probably damaging
Transcript: ENSMUST00000025483
AA Change: V484A

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000025483
Gene: ENSMUSG00000024587
AA Change: V484A

Domain	Start	End	E-Value	Type
coiled coil region	80	112	N/A	INTRINSIC
Pfam:tRNA_anti-codon	139	219	1.2e-12	PFAM
Pfam:tRNA-synt_2	236	554	1.8e-108	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.1%
20x: 97.2%

Validation Efficiency

100% (65/65)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Aminoacyl-tRNA synthetases are a class of enzymes that charge tRNAs with their cognate amino acids. Asparaginyl-tRNA synthetase is localized to the cytoplasm and belongs to the class II family of tRNA synthetases. The N-terminal domain represents the signature sequence for the eukaryotic asparaginyl-tRNA synthetases. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110002E22Rik	A	T	3: 138,068,050	Y1000F	probably damaging	Het
1700018B08Rik	A	G	8: 121,535,421		probably null	Het
Aadat	T	C	8: 60,529,433	F245L	probably damaging	Het
Adcy10	T	G	1: 165,575,658	L1575W	probably damaging	Het
Anks4b	A	T	7: 120,183,008	T421S	probably damaging	Het
Anpep	A	T	7: 79,825,349	I155N	probably damaging	Het
Arnt	T	C	3: 95,490,621	F572L	probably damaging	Het
Brip1	G	A	11: 86,148,536	Q391*	probably null	Het
Brpf3	C	A	17: 28,823,996	H1004N	probably benign	Het
Cand2	T	A	6: 115,791,289	V465D	possibly damaging	Het
Card10	G	T	15: 78,802,409	Y69*	probably null	Het
Catsperd	A	T	17: 56,655,175	K450*	probably null	Het
Ccdc137	T	C	11: 120,460,183	L137P	probably damaging	Het
Cic	T	C	7: 25,290,682	S1905P	probably damaging	Het
Csmd3	C	T	15: 47,644,205	G2971S	probably damaging	Het
Dmxl2	A	G	9: 54,472,212	Y183H	probably damaging	Het
Drosha	T	C	15: 12,834,310	Y167H	unknown	Het
E330034G19Rik	A	G	14: 24,308,242	K214R	unknown	Het
Fam180a	T	G	6: 35,313,830	I73L	possibly damaging	Het
Fbxo28	G	T	1: 182,341,421	H51N	probably benign	Het
Gm12728	T	G	4: 105,790,336		probably null	Het
Gm973	T	C	1: 59,552,461	C335R	possibly damaging	Het
Gpx8	A	G	13: 113,043,236	V177A	probably damaging	Het
Hdlbp	A	G	1: 93,412,361		probably null	Het
Htt	T	G	5: 34,877,100	Y1972D	probably null	Het
Igkv6-14	T	C	6: 70,435,132	Y56C	possibly damaging	Het
Kcnma1	A	G	14: 23,526,534		probably null	Het
Klc1	T	C	12: 111,787,585	S105P	probably damaging	Het
Klhl20	T	C	1: 161,093,696	D63G	possibly damaging	Het
Lamc3	A	G	2: 31,908,689	D469G	probably damaging	Het
Lrit1	G	C	14: 37,060,095	V242L	probably damaging	Het
Mboat4	G	A	8: 34,124,711	R434H	probably benign	Het
Mttp	T	C	3: 138,115,282	K270E	possibly damaging	Het
Muc5ac	G	A	7: 141,793,298	C337Y	possibly damaging	Het
Noxa1	G	T	2: 25,091,832		probably null	Het
Olfr297	A	G	7: 86,527,314	T186A	probably benign	Het
Olfr830	T	A	9: 18,875,525	L63H	probably damaging	Het
Osbpl7	G	A	11: 97,050,758	G36S	probably damaging	Het
P4htm	C	T	9: 108,583,613	G220D	probably benign	Het
Pcdhga7	A	G	18: 37,715,146	I69V	probably benign	Het
Pla2g4e	C	T	2: 120,185,314	E250K	possibly damaging	Het
Plcd4	A	G	1: 74,565,835		probably benign	Het
Ppfia3	C	A	7: 45,358,807	G213V	possibly damaging	Het
Ppp1r1a	A	G	15: 103,533,086	S67P	probably damaging	Het
Prss43	T	C	9: 110,828,612	F193S	probably benign	Het
Rfx1	A	G	8: 84,095,488	Y872C	probably damaging	Het
Rhot1	T	A	11: 80,242,095	N218K	probably benign	Het
Sall1	A	G	8: 89,030,393	F1028L	probably damaging	Het
Siglec1	G	A	2: 131,078,077	Q845*	probably null	Het
Slc38a9	C	T	13: 112,701,526	T275I	possibly damaging	Het
Slc39a4	A	T	15: 76,613,270	S481T	probably damaging	Het
Ssr1	A	T	13: 37,986,022	N191K	probably damaging	Het
Tenm4	A	T	7: 96,895,550	S2258C	probably damaging	Het
Tm7sf3	T	G	6: 146,606,147	R472S	possibly damaging	Het
Tmprss11a	G	A	5: 86,428,635	T119M	probably benign	Het
Traip	C	T	9: 107,961,041	R142*	probably null	Het
Utrn	T	C	10: 12,750,470	N100D	probably damaging	Het
Vmn1r74	T	C	7: 11,847,648	S292P	probably benign	Het
Vmn2r71	A	T	7: 85,623,900	I641F	probably damaging	Het
Vmn2r9	T	A	5: 108,849,046	Y119F	possibly damaging	Het
Vmn2r98	A	G	17: 19,065,248	N110S	probably damaging	Het
Vwce	A	G	19: 10,664,693	T928A	probably benign	Het
Zfp608	T	A	18: 54,988,265	K83N	probably damaging	Het
Zfp808	A	G	13: 62,173,168	H737R	probably benign	Het
Zswim4	T	C	8: 84,214,085	N795S	probably benign	Het

Other mutations in Nars

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01012:Nars	APN	18	64504968	missense	probably damaging	1.00
IGL01962:Nars	APN	18	64510483	missense	probably benign	0.00
IGL01968:Nars	APN	18	64507858	missense	probably damaging	1.00
IGL02288:Nars	APN	18	64510535	splice site	probably benign
IGL02366:Nars	APN	18	64503528	missense	possibly damaging	0.70
IGL02948:Nars	APN	18	64505195	missense	possibly damaging	0.66
FR4976:Nars	UTSW	18	64510445	critical splice donor site	probably benign
R0591:Nars	UTSW	18	64500567	missense	probably damaging	1.00
R1654:Nars	UTSW	18	64512049	missense	probably damaging	1.00
R1691:Nars	UTSW	18	64516414	critical splice donor site	probably null
R1954:Nars	UTSW	18	64500564	missense	probably damaging	1.00
R2006:Nars	UTSW	18	64505028	missense	probably damaging	1.00
R2516:Nars	UTSW	18	64505016	missense	probably damaging	1.00
R3433:Nars	UTSW	18	64509303	missense	probably damaging	1.00
R4378:Nars	UTSW	18	64501353	missense	probably damaging	1.00
R4667:Nars	UTSW	18	64505231	missense	possibly damaging	0.93
R4737:Nars	UTSW	18	64516427	missense	probably benign
R4877:Nars	UTSW	18	64500572	nonsense	probably null
R5950:Nars	UTSW	18	64510485	missense	possibly damaging	0.91
R6434:Nars	UTSW	18	64507801	missense	probably benign	0.01
R7082:Nars	UTSW	18	64504354	missense	possibly damaging	0.68
R7132:Nars	UTSW	18	64507770	critical splice donor site	probably null
R7504:Nars	UTSW	18	64512022	missense	probably benign	0.22
R8120:Nars	UTSW	18	64504351	missense	probably benign	0.19
R8343:Nars	UTSW	18	64504387	missense	probably benign	0.01
R8429:Nars	UTSW	18	64501320	missense	probably damaging	1.00
R8929:Nars	UTSW	18	64511824	missense	probably benign
R9321:Nars	UTSW	18	64504879	missense	probably damaging	1.00
R9397:Nars	UTSW	18	64509256	missense	probably benign	0.30

Predicted Primers

PCR Primer
(F):5'- CGAAACTGACGTATAACTGGGC -3'
(R):5'- TGAGTACTACTTGAACTTTGCGTAG -3'

Sequencing Primer
(F):5'- TGGCAATATCCCAATGCTACATG -3'
(R):5'- GAACTTTGCGTAGTCACATAGC -3'

Posted On

2018-11-06