Incidental Mutation 'R6921:Dis3l2'
ID539619
Institutional Source Beutler Lab
Gene Symbol Dis3l2
Ensembl Gene ENSMUSG00000053333
Gene NameDIS3 like 3'-5' exoribonuclease 2
Synonyms4930429A22Rik, 8030493P09Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.274) question?
Stock #R6921 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location86703808-87050095 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 86857341 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 318 (I318T)
Ref Sequence ENSEMBL: ENSMUSP00000132673 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065694] [ENSMUST00000168237] [ENSMUST00000190618]
Predicted Effect probably benign
Transcript: ENSMUST00000065694
AA Change: I304T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000070506
Gene: ENSMUSG00000053333
AA Change: I304T

DomainStartEndE-ValueType
low complexity region 12 33 N/A INTRINSIC
low complexity region 35 48 N/A INTRINSIC
RNB 369 719 8.9e-140 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000168237
AA Change: I318T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000132673
Gene: ENSMUSG00000053333
AA Change: I318T

DomainStartEndE-ValueType
low complexity region 12 33 N/A INTRINSIC
low complexity region 35 48 N/A INTRINSIC
RNB 383 733 8.9e-140 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000190618
SMART Domains Protein: ENSMUSP00000139579
Gene: ENSMUSG00000053333

DomainStartEndE-ValueType
low complexity region 12 33 N/A INTRINSIC
low complexity region 35 48 N/A INTRINSIC
PDB:2VNU|D 50 123 4e-10 PDB
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.8%
  • 10x: 98.9%
  • 20x: 96.4%
Validation Efficiency 96% (46/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is similar in sequence to 3'/5' exonucleolytic subunits of the RNA exosome. The exosome is a large multimeric ribonucleotide complex responsible for degrading various RNA substrates. Several transcript variants, some protein-coding and some not, have been found for this gene. [provided by RefSeq, Mar 2012]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017B05Rik A T 9: 57,258,736 H118Q probably damaging Het
Adgrl3 T G 5: 81,648,713 V623G probably damaging Het
B9d2 A G 7: 25,686,017 D84G probably damaging Het
Clec1a A T 6: 129,428,864 L268H probably damaging Het
Copa A T 1: 172,111,924 N576I possibly damaging Het
Cyp11b1 T C 15: 74,840,949 T88A probably benign Het
Dmtf1 T C 5: 9,130,654 probably benign Het
Dnah17 C A 11: 118,041,484 A3639S probably damaging Het
Dnajc8 T A 4: 132,544,720 I89N probably damaging Het
Dync2h1 T A 9: 7,102,549 H377L probably benign Het
Elmsan1 A G 12: 84,156,459 S890P probably damaging Het
Erfe T A 1: 91,370,332 I212N probably benign Het
Fam117b A G 1: 59,952,935 T248A probably damaging Het
Fbxo10 A T 4: 45,044,849 N595K probably damaging Het
Fzd10 T A 5: 128,601,582 M122K probably damaging Het
Gm4070 G A 7: 105,901,980 Q622* probably null Het
Gpr15 C T 16: 58,717,781 R315H probably benign Het
H6pd T C 4: 149,982,051 D626G probably damaging Het
Hexdc A G 11: 121,222,281 D514G probably damaging Het
Hoxd4 T C 2: 74,728,492 S220P possibly damaging Het
Invs A G 4: 48,396,260 H311R possibly damaging Het
Ip6k1 A G 9: 108,024,435 T70A probably damaging Het
Lipt2 T C 7: 100,160,371 C222R probably damaging Het
Lrrc3 T A 10: 77,901,032 D190V probably damaging Het
March10 T C 11: 105,389,777 T561A probably benign Het
Mcm10 G A 2: 5,000,935 T463I probably benign Het
Mmel1 T C 4: 154,881,677 L52P probably damaging Het
Nipbl T C 15: 8,303,485 N2218S probably benign Het
Nr4a3 C T 4: 48,051,486 P80L probably benign Het
Nrip1 C T 16: 76,292,588 G694R possibly damaging Het
Oit3 A T 10: 59,435,945 C197S probably damaging Het
Olfr1042 C T 2: 86,159,852 V173M probably benign Het
Olfr904 A G 9: 38,464,247 I69V probably benign Het
Otol1 A G 3: 70,028,100 E475G possibly damaging Het
Pes1 T C 11: 3,973,330 F168L probably damaging Het
Plch1 C T 3: 63,707,734 R780H possibly damaging Het
Pxdn C G 12: 30,015,505 P1275A probably damaging Het
Sgcz T C 8: 37,526,289 E218G probably damaging Het
Slc27a5 A T 7: 12,991,208 N437K probably damaging Het
Sult2b1 A G 7: 45,735,188 S155P probably damaging Het
Tgfbrap1 T C 1: 43,051,896 M690V probably benign Het
Tmem151a A T 19: 5,083,091 L29Q probably damaging Het
Tmprss2 A G 16: 97,568,437 I379T probably damaging Het
Vmn1r168 T A 7: 23,540,898 V60E probably damaging Het
Vmn2r73 A C 7: 85,858,238 V622G probably benign Het
Wdr72 A G 9: 74,210,646 H880R probably benign Het
Zfhx3 A G 8: 108,951,392 T3025A possibly damaging Het
Other mutations in Dis3l2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01382:Dis3l2 APN 1 86857203 missense probably benign 0.00
IGL01607:Dis3l2 APN 1 86745487 missense probably benign 0.04
IGL02233:Dis3l2 APN 1 86990231 missense probably damaging 1.00
IGL02698:Dis3l2 APN 1 87048829 splice site probably benign
R0514:Dis3l2 UTSW 1 87047092 missense probably damaging 1.00
R0893:Dis3l2 UTSW 1 87044206 splice site probably null
R1086:Dis3l2 UTSW 1 86990149 missense probably benign 0.36
R1140:Dis3l2 UTSW 1 86821438 missense probably benign 0.00
R1509:Dis3l2 UTSW 1 87021086 missense possibly damaging 0.91
R2029:Dis3l2 UTSW 1 86854467 splice site probably benign
R2511:Dis3l2 UTSW 1 86990258 missense probably benign 0.05
R3772:Dis3l2 UTSW 1 86854408 missense probably benign
R4163:Dis3l2 UTSW 1 86821237 missense probably benign 0.00
R4547:Dis3l2 UTSW 1 87049671 missense probably benign 0.00
R4548:Dis3l2 UTSW 1 87049671 missense probably benign 0.00
R4650:Dis3l2 UTSW 1 86990321 missense possibly damaging 0.83
R4810:Dis3l2 UTSW 1 87047574 missense probably damaging 0.99
R4936:Dis3l2 UTSW 1 87044168 missense probably benign 0.00
R5010:Dis3l2 UTSW 1 86760321 missense probably benign 0.21
R5040:Dis3l2 UTSW 1 86857337 missense probably damaging 0.98
R5272:Dis3l2 UTSW 1 86973404 missense possibly damaging 0.72
R5500:Dis3l2 UTSW 1 87021119 critical splice donor site probably null
R5556:Dis3l2 UTSW 1 86973404 missense possibly damaging 0.72
R5772:Dis3l2 UTSW 1 86878432 missense probably damaging 1.00
R5808:Dis3l2 UTSW 1 87049638 missense possibly damaging 0.94
R5950:Dis3l2 UTSW 1 87021108 missense probably damaging 0.96
R6328:Dis3l2 UTSW 1 86854431 missense probably benign 0.05
R6553:Dis3l2 UTSW 1 86745494 missense probably damaging 1.00
R6585:Dis3l2 UTSW 1 86745494 missense probably damaging 1.00
R6905:Dis3l2 UTSW 1 87044839 missense probably benign 0.00
R7162:Dis3l2 UTSW 1 87044030 missense possibly damaging 0.94
R7270:Dis3l2 UTSW 1 86990303 missense possibly damaging 0.49
R7438:Dis3l2 UTSW 1 86745500 critical splice donor site probably null
X0027:Dis3l2 UTSW 1 86760351 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- GCAACTGGCATCCTGAAACTC -3'
(R):5'- TGTTTGCCTGGTAATCCAAGACATC -3'

Sequencing Primer
(F):5'- CTCTTGGCTGATAAGAACAGTGACC -3'
(R):5'- ACATCTATAGGTGACCTATGGGC -3'
Posted On2018-11-06