Mutagenetix > Incidental Mutations

Incidental Mutation 'R6921:Dis3l2'

539619

Institutional Source

Beutler Lab

Gene Symbol

Dis3l2

Ensembl Gene

ENSMUSG00000053333

Gene Name

DIS3 like 3'-5' exoribonuclease 2

Synonyms

4930429A22Rik, 8030493P09Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.342) question?

Stock #

R6921 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

86703808-87050095 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 86857341 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 318 (I318T)

Ref Sequence

ENSEMBL: ENSMUSP00000132673 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000065694] [ENSMUST00000168237] [ENSMUST00000190618]

AlphaFold

Q8CI75

Predicted Effect

probably benign
Transcript: ENSMUST00000065694
AA Change: I304T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000070506
Gene: ENSMUSG00000053333
AA Change: I304T

Domain	Start	End	E-Value	Type
low complexity region	12	33	N/A	INTRINSIC
low complexity region	35	48	N/A	INTRINSIC
RNB	369	719	8.9e-140	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000168237
AA Change: I318T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000132673
Gene: ENSMUSG00000053333
AA Change: I318T

Domain	Start	End	E-Value	Type
low complexity region	12	33	N/A	INTRINSIC
low complexity region	35	48	N/A	INTRINSIC
RNB	383	733	8.9e-140	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000190618

SMART Domains

Protein: ENSMUSP00000139579
Gene: ENSMUSG00000053333

Domain	Start	End	E-Value	Type
low complexity region	12	33	N/A	INTRINSIC
low complexity region	35	48	N/A	INTRINSIC
PDB:2VNU\|D	50	123	4e-10	PDB

Meta Mutation Damage Score

0.0846

Coding Region Coverage

1x: 100.0%
3x: 99.8%
10x: 98.9%
20x: 96.4%

Validation Efficiency

96% (46/48)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is similar in sequence to 3'/5' exonucleolytic subunits of the RNA exosome. The exosome is a large multimeric ribonucleotide complex responsible for degrading various RNA substrates. Several transcript variants, some protein-coding and some not, have been found for this gene. [provided by RefSeq, Mar 2012]

Allele List at MGI

Other mutations in this stock

Total: 47 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700017B05Rik	A	T	9: 57,258,736	H118Q	probably damaging	Het
Adgrl3	T	G	5: 81,648,713	V623G	probably damaging	Het
B9d2	A	G	7: 25,686,017	D84G	probably damaging	Het
Clec1a	A	T	6: 129,428,864	L268H	probably damaging	Het
Copa	A	T	1: 172,111,924	N576I	possibly damaging	Het
Cyp11b1	T	C	15: 74,840,949	T88A	probably benign	Het
Dmtf1	T	C	5: 9,130,654		probably benign	Het
Dnah17	C	A	11: 118,041,484	A3639S	probably damaging	Het
Dnajc8	T	A	4: 132,544,720	I89N	probably damaging	Het
Dync2h1	T	A	9: 7,102,549	H377L	probably benign	Het
Elmsan1	A	G	12: 84,156,459	S890P	probably damaging	Het
Erfe	T	A	1: 91,370,332	I212N	probably benign	Het
Fam117b	A	G	1: 59,952,935	T248A	probably damaging	Het
Fbxo10	A	T	4: 45,044,849	N595K	probably damaging	Het
Fzd10	T	A	5: 128,601,582	M122K	probably damaging	Het
Gm4070	G	A	7: 105,901,980	Q622*	probably null	Het
Gpr15	C	T	16: 58,717,781	R315H	probably benign	Het
H6pd	T	C	4: 149,982,051	D626G	probably damaging	Het
Hexdc	A	G	11: 121,222,281	D514G	probably damaging	Het
Hoxd4	T	C	2: 74,728,492	S220P	possibly damaging	Het
Invs	A	G	4: 48,396,260	H311R	possibly damaging	Het
Ip6k1	A	G	9: 108,024,435	T70A	probably damaging	Het
Lipt2	T	C	7: 100,160,371	C222R	probably damaging	Het
Lrrc3	T	A	10: 77,901,032	D190V	probably damaging	Het
March10	T	C	11: 105,389,777	T561A	probably benign	Het
Mcm10	G	A	2: 5,000,935	T463I	probably benign	Het
Mmel1	T	C	4: 154,881,677	L52P	probably damaging	Het
Nipbl	T	C	15: 8,303,485	N2218S	probably benign	Het
Nr4a3	C	T	4: 48,051,486	P80L	probably benign	Het
Nrip1	C	T	16: 76,292,588	G694R	possibly damaging	Het
Oit3	A	T	10: 59,435,945	C197S	probably damaging	Het
Olfr1042	C	T	2: 86,159,852	V173M	probably benign	Het
Olfr904	A	G	9: 38,464,247	I69V	probably benign	Het
Otol1	A	G	3: 70,028,100	E475G	possibly damaging	Het
Pes1	T	C	11: 3,973,330	F168L	probably damaging	Het
Plch1	C	T	3: 63,707,734	R780H	possibly damaging	Het
Pxdn	C	G	12: 30,015,505	P1275A	probably damaging	Het
Sgcz	T	C	8: 37,526,289	E218G	probably damaging	Het
Slc27a5	A	T	7: 12,991,208	N437K	probably damaging	Het
Sult2b1	A	G	7: 45,735,188	S155P	probably damaging	Het
Tgfbrap1	T	C	1: 43,051,896	M690V	probably benign	Het
Tmem151a	A	T	19: 5,083,091	L29Q	probably damaging	Het
Tmprss2	A	G	16: 97,568,437	I379T	probably damaging	Het
Vmn1r168	T	A	7: 23,540,898	V60E	probably damaging	Het
Vmn2r73	A	C	7: 85,858,238	V622G	probably benign	Het
Wdr72	A	G	9: 74,210,646	H880R	probably benign	Het
Zfhx3	A	G	8: 108,951,392	T3025A	possibly damaging	Het

Other mutations in Dis3l2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01382:Dis3l2	APN	1	86857203	missense	probably benign	0.00
IGL01607:Dis3l2	APN	1	86745487	missense	probably benign	0.04
IGL02233:Dis3l2	APN	1	86990231	missense	probably damaging	1.00
IGL02698:Dis3l2	APN	1	87048829	splice site	probably benign
R0514:Dis3l2	UTSW	1	87047092	missense	probably damaging	1.00
R0893:Dis3l2	UTSW	1	87044206	splice site	probably null
R1086:Dis3l2	UTSW	1	86990149	missense	probably benign	0.36
R1140:Dis3l2	UTSW	1	86821438	missense	probably benign	0.00
R1509:Dis3l2	UTSW	1	87021086	missense	possibly damaging	0.91
R2029:Dis3l2	UTSW	1	86854467	splice site	probably benign
R2511:Dis3l2	UTSW	1	86990258	missense	probably benign	0.05
R3772:Dis3l2	UTSW	1	86854408	missense	probably benign
R4163:Dis3l2	UTSW	1	86821237	missense	probably benign	0.00
R4547:Dis3l2	UTSW	1	87049671	missense	probably benign	0.00
R4548:Dis3l2	UTSW	1	87049671	missense	probably benign	0.00
R4650:Dis3l2	UTSW	1	86990321	missense	possibly damaging	0.83
R4810:Dis3l2	UTSW	1	87047574	missense	probably damaging	0.99
R4936:Dis3l2	UTSW	1	87044168	missense	probably benign	0.00
R5010:Dis3l2	UTSW	1	86760321	missense	probably benign	0.21
R5040:Dis3l2	UTSW	1	86857337	missense	probably damaging	0.98
R5272:Dis3l2	UTSW	1	86973404	missense	possibly damaging	0.72
R5500:Dis3l2	UTSW	1	87021119	critical splice donor site	probably null
R5556:Dis3l2	UTSW	1	86973404	missense	possibly damaging	0.72
R5772:Dis3l2	UTSW	1	86878432	missense	probably damaging	1.00
R5808:Dis3l2	UTSW	1	87049638	missense	possibly damaging	0.94
R5950:Dis3l2	UTSW	1	87021108	missense	probably damaging	0.96
R6328:Dis3l2	UTSW	1	86854431	missense	probably benign	0.05
R6553:Dis3l2	UTSW	1	86745494	missense	probably damaging	1.00
R6585:Dis3l2	UTSW	1	86745494	missense	probably damaging	1.00
R6905:Dis3l2	UTSW	1	87044839	missense	probably benign	0.00
R7162:Dis3l2	UTSW	1	87044030	missense	possibly damaging	0.94
R7270:Dis3l2	UTSW	1	86990303	missense	possibly damaging	0.49
R7438:Dis3l2	UTSW	1	86745500	critical splice donor site	probably null
R8422:Dis3l2	UTSW	1	86854377	missense	probably benign
R8696:Dis3l2	UTSW	1	86791440	nonsense	probably null
R9235:Dis3l2	UTSW	1	86821339	missense	possibly damaging	0.95
R9291:Dis3l2	UTSW	1	86973493	missense	possibly damaging	0.82
X0027:Dis3l2	UTSW	1	86760351	missense	possibly damaging	0.93

Predicted Primers

PCR Primer
(F):5'- GCAACTGGCATCCTGAAACTC -3'
(R):5'- TGTTTGCCTGGTAATCCAAGACATC -3'

Sequencing Primer
(F):5'- CTCTTGGCTGATAAGAACAGTGACC -3'
(R):5'- ACATCTATAGGTGACCTATGGGC -3'

Posted On

2018-11-06