Incidental Mutation 'R6921:Hoxd4'
ID539623
Institutional Source Beutler Lab
Gene Symbol Hoxd4
Ensembl Gene ENSMUSG00000101174
Gene Namehomeobox D4
SynonymsHox-4.2, Hox-5.1
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.356) question?
Stock #R6921 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location74711929-74729123 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 74728492 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 220 (S220P)
Ref Sequence ENSEMBL: ENSMUSP00000107611 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047904] [ENSMUST00000053932] [ENSMUST00000111980] [ENSMUST00000111983] [ENSMUST00000144544]
Predicted Effect possibly damaging
Transcript: ENSMUST00000047904
AA Change: S220P

PolyPhen 2 Score 0.734 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000047949
Gene: ENSMUSG00000115956
AA Change: S220P

DomainStartEndE-ValueType
low complexity region 63 70 N/A INTRINSIC
low complexity region 91 110 N/A INTRINSIC
low complexity region 112 123 N/A INTRINSIC
HOX 152 214 2.46e-26 SMART
low complexity region 220 229 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000053932
SMART Domains Protein: ENSMUSP00000051355
Gene: ENSMUSG00000100642

DomainStartEndE-ValueType
low complexity region 93 135 N/A INTRINSIC
low complexity region 141 159 N/A INTRINSIC
HOX 195 257 5.83e-28 SMART
Pfam:DUF4074 370 431 1.4e-33 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000111980
AA Change: S220P

PolyPhen 2 Score 0.734 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000107611
Gene: ENSMUSG00000101174
AA Change: S220P

DomainStartEndE-ValueType
low complexity region 63 70 N/A INTRINSIC
low complexity region 91 110 N/A INTRINSIC
low complexity region 112 123 N/A INTRINSIC
HOX 152 214 2.46e-26 SMART
low complexity region 220 229 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111983
SMART Domains Protein: ENSMUSP00000107614
Gene: ENSMUSG00000079277

DomainStartEndE-ValueType
low complexity region 93 135 N/A INTRINSIC
low complexity region 141 159 N/A INTRINSIC
HOX 195 257 5.83e-28 SMART
Pfam:DUF4074 369 431 8.9e-35 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000144544
Meta Mutation Damage Score 0.4192 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.8%
  • 10x: 98.9%
  • 20x: 96.4%
Validation Efficiency 96% (46/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the homeobox family of genes. The homeobox genes encode a highly conserved family of transcription factors that play an important role in morphogenesis in all multicellular organisms. Mammals possess four similar homeobox gene clusters, HOXA, HOXB, HOXC and HOXD, located on different chromosomes, consisting of 9 to 11 genes arranged in tandem. This gene is one of several homeobox HOXD genes located at 2q31-2q37 chromosome regions. Deletions that removed the entire HOXD gene cluster or 5' end of this cluster have been associated with severe limb and genital abnormalities. The protein encoded by this gene may play a role in determining positional values in developing limb buds. Alternatively spliced variants have been described but their full length nature has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Both homozygotes and heterozygotes for a targeted null mutation exhibit homeotic transformations of the second cervical vertebrae and malformed neural arches of C1 to C3 and of the basioccipital bone. Mutants show variable penetrance and expressivity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017B05Rik A T 9: 57,258,736 H118Q probably damaging Het
Adgrl3 T G 5: 81,648,713 V623G probably damaging Het
B9d2 A G 7: 25,686,017 D84G probably damaging Het
Clec1a A T 6: 129,428,864 L268H probably damaging Het
Copa A T 1: 172,111,924 N576I possibly damaging Het
Cyp11b1 T C 15: 74,840,949 T88A probably benign Het
Dis3l2 T C 1: 86,857,341 I318T probably benign Het
Dmtf1 T C 5: 9,130,654 probably benign Het
Dnah17 C A 11: 118,041,484 A3639S probably damaging Het
Dnajc8 T A 4: 132,544,720 I89N probably damaging Het
Dync2h1 T A 9: 7,102,549 H377L probably benign Het
Elmsan1 A G 12: 84,156,459 S890P probably damaging Het
Erfe T A 1: 91,370,332 I212N probably benign Het
Fam117b A G 1: 59,952,935 T248A probably damaging Het
Fbxo10 A T 4: 45,044,849 N595K probably damaging Het
Fzd10 T A 5: 128,601,582 M122K probably damaging Het
Gm4070 G A 7: 105,901,980 Q622* probably null Het
Gpr15 C T 16: 58,717,781 R315H probably benign Het
H6pd T C 4: 149,982,051 D626G probably damaging Het
Hexdc A G 11: 121,222,281 D514G probably damaging Het
Invs A G 4: 48,396,260 H311R possibly damaging Het
Ip6k1 A G 9: 108,024,435 T70A probably damaging Het
Lipt2 T C 7: 100,160,371 C222R probably damaging Het
Lrrc3 T A 10: 77,901,032 D190V probably damaging Het
March10 T C 11: 105,389,777 T561A probably benign Het
Mcm10 G A 2: 5,000,935 T463I probably benign Het
Mmel1 T C 4: 154,881,677 L52P probably damaging Het
Nipbl T C 15: 8,303,485 N2218S probably benign Het
Nr4a3 C T 4: 48,051,486 P80L probably benign Het
Nrip1 C T 16: 76,292,588 G694R possibly damaging Het
Oit3 A T 10: 59,435,945 C197S probably damaging Het
Olfr1042 C T 2: 86,159,852 V173M probably benign Het
Olfr904 A G 9: 38,464,247 I69V probably benign Het
Otol1 A G 3: 70,028,100 E475G possibly damaging Het
Pes1 T C 11: 3,973,330 F168L probably damaging Het
Plch1 C T 3: 63,707,734 R780H possibly damaging Het
Pxdn C G 12: 30,015,505 P1275A probably damaging Het
Sgcz T C 8: 37,526,289 E218G probably damaging Het
Slc27a5 A T 7: 12,991,208 N437K probably damaging Het
Sult2b1 A G 7: 45,735,188 S155P probably damaging Het
Tgfbrap1 T C 1: 43,051,896 M690V probably benign Het
Tmem151a A T 19: 5,083,091 L29Q probably damaging Het
Tmprss2 A G 16: 97,568,437 I379T probably damaging Het
Vmn1r168 T A 7: 23,540,898 V60E probably damaging Het
Vmn2r73 A C 7: 85,858,238 V622G probably benign Het
Wdr72 A G 9: 74,210,646 H880R probably benign Het
Zfhx3 A G 8: 108,951,392 T3025A possibly damaging Het
Other mutations in Hoxd4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02034:Hoxd4 APN 2 74728406 missense probably damaging 0.98
IGL03403:Hoxd4 APN 2 74728337 missense possibly damaging 0.93
R0153:Hoxd4 UTSW 2 74727457 missense probably damaging 0.96
R3424:Hoxd4 UTSW 2 74727313 missense probably damaging 1.00
R5447:Hoxd4 UTSW 2 74727343 missense probably damaging 1.00
R5715:Hoxd4 UTSW 2 74727364 missense probably damaging 1.00
R6197:Hoxd4 UTSW 2 74728463 missense possibly damaging 0.85
R6264:Hoxd4 UTSW 2 74727385 missense possibly damaging 0.53
R6310:Hoxd4 UTSW 2 74728390 missense possibly damaging 0.84
R6336:Hoxd4 UTSW 2 74727361 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GACAGCAAGTCCTAGAACTGG -3'
(R):5'- CAGGAAGGTAACCTAGTCCGAG -3'

Sequencing Primer
(F):5'- GTCCTAGAACTGGAAAAGGAATTTC -3'
(R):5'- CAGTACCTTAGAGCCCAGTGAG -3'
Posted On2018-11-06