Mutagenetix > Incidental Mutations

Incidental Mutation 'R6921:Nr4a3'

539628

Institutional Source

Beutler Lab

Gene Symbol

Nr4a3

Ensembl Gene

ENSMUSG00000028341

Gene Name

nuclear receptor subfamily 4, group A, member 3

Synonyms

Nor1, TEC, MINOR, NOR-1

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R6921 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

48045153-48086447 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 48051486 bp

Zygosity

Heterozygous

Amino Acid Change

Proline to Leucine at position 80 (P80L)

Ref Sequence

ENSEMBL: ENSMUSP00000030025 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000030025]

Predicted Effect

probably benign
Transcript: ENSMUST00000030025
AA Change: P80L

PolyPhen 2 Score 0.040 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000030025
Gene: ENSMUSG00000028341
AA Change: P80L

Domain	Start	End	E-Value	Type
Blast:HOLI	1	43	4e-18	BLAST
low complexity region	99	115	N/A	INTRINSIC
low complexity region	139	151	N/A	INTRINSIC
low complexity region	196	210	N/A	INTRINSIC
low complexity region	218	239	N/A	INTRINSIC
low complexity region	269	288	N/A	INTRINSIC
ZnF_C4	290	361	4.57e-39	SMART
low complexity region	376	396	N/A	INTRINSIC
HOLI	440	595	2.46e-21	SMART

Predicted Effect

SMART Domains

Protein: ENSMUSP00000121455
Gene: ENSMUSG00000028341
AA Change: P109L

Domain	Start	End	E-Value	Type
Blast:HOLI	30	73	8e-19	BLAST
low complexity region	129	145	N/A	INTRINSIC
low complexity region	169	181	N/A	INTRINSIC
low complexity region	226	240	N/A	INTRINSIC
low complexity region	248	269	N/A	INTRINSIC
low complexity region	299	318	N/A	INTRINSIC
ZnF_C4	320	391	4.57e-39	SMART
low complexity region	406	426	N/A	INTRINSIC
HOLI	470	625	2.46e-21	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.8%
10x: 98.9%
20x: 96.4%

Validation Efficiency

96% (46/48)

MGI Phenotype

FUNCTION: This gene encodes a member of the NR4A subfamily of nuclear hormone receptors that bind to DNA and modulate gene expression. The encoded protein has been implicated in T and B lymphocyte apoptosis, and immune cell proliferation. Mice lacking the encoded protein exhibit partial bidirectional circling behavior and inner ear dysfunction. Disruption of this gene in mice also results in defective hippocampal axonal growth and postnatal neuronal cell death. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Apr 2015]
PHENOTYPE: Mice homozygous for a null allele exhibit defects in the semicircular canals of the inner ear and bidirectional circling behavior. Mice homozygous for another null allele display embryonic lethality with impaired cell migration during gastrulation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 47 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700017B05Rik	A	T	9: 57,258,736	H118Q	probably damaging	Het
Adgrl3	T	G	5: 81,648,713	V623G	probably damaging	Het
B9d2	A	G	7: 25,686,017	D84G	probably damaging	Het
Clec1a	A	T	6: 129,428,864	L268H	probably damaging	Het
Copa	A	T	1: 172,111,924	N576I	possibly damaging	Het
Cyp11b1	T	C	15: 74,840,949	T88A	probably benign	Het
Dis3l2	T	C	1: 86,857,341	I318T	probably benign	Het
Dmtf1	T	C	5: 9,130,654		probably benign	Het
Dnah17	C	A	11: 118,041,484	A3639S	probably damaging	Het
Dnajc8	T	A	4: 132,544,720	I89N	probably damaging	Het
Dync2h1	T	A	9: 7,102,549	H377L	probably benign	Het
Elmsan1	A	G	12: 84,156,459	S890P	probably damaging	Het
Erfe	T	A	1: 91,370,332	I212N	probably benign	Het
Fam117b	A	G	1: 59,952,935	T248A	probably damaging	Het
Fbxo10	A	T	4: 45,044,849	N595K	probably damaging	Het
Fzd10	T	A	5: 128,601,582	M122K	probably damaging	Het
Gm4070	G	A	7: 105,901,980	Q622*	probably null	Het
Gpr15	C	T	16: 58,717,781	R315H	probably benign	Het
H6pd	T	C	4: 149,982,051	D626G	probably damaging	Het
Hexdc	A	G	11: 121,222,281	D514G	probably damaging	Het
Hoxd4	T	C	2: 74,728,492	S220P	possibly damaging	Het
Invs	A	G	4: 48,396,260	H311R	possibly damaging	Het
Ip6k1	A	G	9: 108,024,435	T70A	probably damaging	Het
Lipt2	T	C	7: 100,160,371	C222R	probably damaging	Het
Lrrc3	T	A	10: 77,901,032	D190V	probably damaging	Het
March10	T	C	11: 105,389,777	T561A	probably benign	Het
Mcm10	G	A	2: 5,000,935	T463I	probably benign	Het
Mmel1	T	C	4: 154,881,677	L52P	probably damaging	Het
Nipbl	T	C	15: 8,303,485	N2218S	probably benign	Het
Nrip1	C	T	16: 76,292,588	G694R	possibly damaging	Het
Oit3	A	T	10: 59,435,945	C197S	probably damaging	Het
Olfr1042	C	T	2: 86,159,852	V173M	probably benign	Het
Olfr904	A	G	9: 38,464,247	I69V	probably benign	Het
Otol1	A	G	3: 70,028,100	E475G	possibly damaging	Het
Pes1	T	C	11: 3,973,330	F168L	probably damaging	Het
Plch1	C	T	3: 63,707,734	R780H	possibly damaging	Het
Pxdn	C	G	12: 30,015,505	P1275A	probably damaging	Het
Sgcz	T	C	8: 37,526,289	E218G	probably damaging	Het
Slc27a5	A	T	7: 12,991,208	N437K	probably damaging	Het
Sult2b1	A	G	7: 45,735,188	S155P	probably damaging	Het
Tgfbrap1	T	C	1: 43,051,896	M690V	probably benign	Het
Tmem151a	A	T	19: 5,083,091	L29Q	probably damaging	Het
Tmprss2	A	G	16: 97,568,437	I379T	probably damaging	Het
Vmn1r168	T	A	7: 23,540,898	V60E	probably damaging	Het
Vmn2r73	A	C	7: 85,858,238	V622G	probably benign	Het
Wdr72	A	G	9: 74,210,646	H880R	probably benign	Het
Zfhx3	A	G	8: 108,951,392	T3025A	possibly damaging	Het

Other mutations in Nr4a3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01362:Nr4a3	APN	4	48051586	missense	possibly damaging	0.48
IGL01407:Nr4a3	APN	4	48083201	missense	probably benign	0.00
IGL01454:Nr4a3	APN	4	48067803	missense	probably damaging	1.00
IGL01472:Nr4a3	APN	4	48071133	missense	probably damaging	1.00
IGL02622:Nr4a3	APN	4	48051649	missense	probably benign	0.06
IGL03401:Nr4a3	APN	4	48070987	splice site	probably null
bulbous	UTSW	4	48083255	missense	probably damaging	0.98
cronus	UTSW	4	48056539	missense	probably damaging	1.00
I1329:Nr4a3	UTSW	4	48051585	missense	probably benign	0.12
R0486:Nr4a3	UTSW	4	48056525	splice site	probably benign
R0610:Nr4a3	UTSW	4	48051903	missense	probably benign	0.10
R1170:Nr4a3	UTSW	4	48051564	missense	probably damaging	0.98
R1170:Nr4a3	UTSW	4	48083324	missense	probably benign	0.01
R1440:Nr4a3	UTSW	4	48051777	missense	probably benign
R1977:Nr4a3	UTSW	4	48056539	missense	probably damaging	1.00
R2016:Nr4a3	UTSW	4	48083252	missense	probably damaging	1.00
R2046:Nr4a3	UTSW	4	48067807	missense	possibly damaging	0.82
R2055:Nr4a3	UTSW	4	48067771	missense	possibly damaging	0.86
R3707:Nr4a3	UTSW	4	48056699	missense	probably damaging	0.99
R3708:Nr4a3	UTSW	4	48056699	missense	probably damaging	0.99
R4246:Nr4a3	UTSW	4	48083125	missense	possibly damaging	0.86
R4657:Nr4a3	UTSW	4	48051522	missense	probably damaging	1.00
R4870:Nr4a3	UTSW	4	48051651	missense	possibly damaging	0.73
R5434:Nr4a3	UTSW	4	48067861	missense	probably damaging	1.00
R5539:Nr4a3	UTSW	4	48056525	splice site	probably null
R5663:Nr4a3	UTSW	4	48055931	missense	probably damaging	1.00
R6513:Nr4a3	UTSW	4	48083255	missense	probably damaging	0.98
R6664:Nr4a3	UTSW	4	48056006	missense	probably damaging	1.00
R6940:Nr4a3	UTSW	4	48051486	missense	probably benign	0.04
R7076:Nr4a3	UTSW	4	48055957	missense	probably damaging	1.00
R7322:Nr4a3	UTSW	4	48083238	missense	probably benign	0.00
R7347:Nr4a3	UTSW	4	48051290	missense	possibly damaging	0.94
R7348:Nr4a3	UTSW	4	48051290	missense	possibly damaging	0.94
R7349:Nr4a3	UTSW	4	48051290	missense	possibly damaging	0.94
R7361:Nr4a3	UTSW	4	48083203	missense	probably benign	0.00
R7365:Nr4a3	UTSW	4	48051290	missense	possibly damaging	0.94
R7366:Nr4a3	UTSW	4	48051290	missense	possibly damaging	0.94
R7418:Nr4a3	UTSW	4	48051476	missense	probably damaging	1.00
R7659:Nr4a3	UTSW	4	48051269	missense	probably damaging	1.00
R7895:Nr4a3	UTSW	4	48051390	missense	probably benign
R7986:Nr4a3	UTSW	4	48055954	missense	probably damaging	1.00
R8022:Nr4a3	UTSW	4	48051510	missense	probably damaging	1.00
R8226:Nr4a3	UTSW	4	48056588	missense	probably damaging	1.00
R8328:Nr4a3	UTSW	4	48051323	missense	probably damaging	1.00
R8349:Nr4a3	UTSW	4	48052170	missense	probably benign	0.40
R8403:Nr4a3	UTSW	4	48051348	missense	probably damaging	1.00
R8449:Nr4a3	UTSW	4	48052170	missense	probably benign	0.40

Predicted Primers

PCR Primer
(F):5'- AGCCCAGTATAGCCCTTCAC -3'
(R):5'- CTGCTTGAAGTACATGGAGGTGC -3'

Sequencing Primer
(F):5'- CGCAGACTTATGGCTCGGAATAC -3'
(R):5'- TGCTGGGCAGTACCTCGTC -3'

Posted On

2018-11-06