Incidental Mutation 'R6921:Nr4a3'
ID539628
Institutional Source Beutler Lab
Gene Symbol Nr4a3
Ensembl Gene ENSMUSG00000028341
Gene Namenuclear receptor subfamily 4, group A, member 3
SynonymsNor1, TEC, MINOR, NOR-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6921 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location48045153-48086447 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 48051486 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 80 (P80L)
Ref Sequence ENSEMBL: ENSMUSP00000030025 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030025]
Predicted Effect probably benign
Transcript: ENSMUST00000030025
AA Change: P80L

PolyPhen 2 Score 0.040 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000030025
Gene: ENSMUSG00000028341
AA Change: P80L

DomainStartEndE-ValueType
Blast:HOLI 1 43 4e-18 BLAST
low complexity region 99 115 N/A INTRINSIC
low complexity region 139 151 N/A INTRINSIC
low complexity region 196 210 N/A INTRINSIC
low complexity region 218 239 N/A INTRINSIC
low complexity region 269 288 N/A INTRINSIC
ZnF_C4 290 361 4.57e-39 SMART
low complexity region 376 396 N/A INTRINSIC
HOLI 440 595 2.46e-21 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000121455
Gene: ENSMUSG00000028341
AA Change: P109L

DomainStartEndE-ValueType
Blast:HOLI 30 73 8e-19 BLAST
low complexity region 129 145 N/A INTRINSIC
low complexity region 169 181 N/A INTRINSIC
low complexity region 226 240 N/A INTRINSIC
low complexity region 248 269 N/A INTRINSIC
low complexity region 299 318 N/A INTRINSIC
ZnF_C4 320 391 4.57e-39 SMART
low complexity region 406 426 N/A INTRINSIC
HOLI 470 625 2.46e-21 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.8%
  • 10x: 98.9%
  • 20x: 96.4%
Validation Efficiency 96% (46/48)
MGI Phenotype FUNCTION: This gene encodes a member of the NR4A subfamily of nuclear hormone receptors that bind to DNA and modulate gene expression. The encoded protein has been implicated in T and B lymphocyte apoptosis, and immune cell proliferation. Mice lacking the encoded protein exhibit partial bidirectional circling behavior and inner ear dysfunction. Disruption of this gene in mice also results in defective hippocampal axonal growth and postnatal neuronal cell death. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Apr 2015]
PHENOTYPE: Mice homozygous for a null allele exhibit defects in the semicircular canals of the inner ear and bidirectional circling behavior. Mice homozygous for another null allele display embryonic lethality with impaired cell migration during gastrulation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017B05Rik A T 9: 57,258,736 H118Q probably damaging Het
Adgrl3 T G 5: 81,648,713 V623G probably damaging Het
B9d2 A G 7: 25,686,017 D84G probably damaging Het
Clec1a A T 6: 129,428,864 L268H probably damaging Het
Copa A T 1: 172,111,924 N576I possibly damaging Het
Cyp11b1 T C 15: 74,840,949 T88A probably benign Het
Dis3l2 T C 1: 86,857,341 I318T probably benign Het
Dmtf1 T C 5: 9,130,654 probably benign Het
Dnah17 C A 11: 118,041,484 A3639S probably damaging Het
Dnajc8 T A 4: 132,544,720 I89N probably damaging Het
Dync2h1 T A 9: 7,102,549 H377L probably benign Het
Elmsan1 A G 12: 84,156,459 S890P probably damaging Het
Erfe T A 1: 91,370,332 I212N probably benign Het
Fam117b A G 1: 59,952,935 T248A probably damaging Het
Fbxo10 A T 4: 45,044,849 N595K probably damaging Het
Fzd10 T A 5: 128,601,582 M122K probably damaging Het
Gm4070 G A 7: 105,901,980 Q622* probably null Het
Gpr15 C T 16: 58,717,781 R315H probably benign Het
H6pd T C 4: 149,982,051 D626G probably damaging Het
Hexdc A G 11: 121,222,281 D514G probably damaging Het
Hoxd4 T C 2: 74,728,492 S220P possibly damaging Het
Invs A G 4: 48,396,260 H311R possibly damaging Het
Ip6k1 A G 9: 108,024,435 T70A probably damaging Het
Lipt2 T C 7: 100,160,371 C222R probably damaging Het
Lrrc3 T A 10: 77,901,032 D190V probably damaging Het
March10 T C 11: 105,389,777 T561A probably benign Het
Mcm10 G A 2: 5,000,935 T463I probably benign Het
Mmel1 T C 4: 154,881,677 L52P probably damaging Het
Nipbl T C 15: 8,303,485 N2218S probably benign Het
Nrip1 C T 16: 76,292,588 G694R possibly damaging Het
Oit3 A T 10: 59,435,945 C197S probably damaging Het
Olfr1042 C T 2: 86,159,852 V173M probably benign Het
Olfr904 A G 9: 38,464,247 I69V probably benign Het
Otol1 A G 3: 70,028,100 E475G possibly damaging Het
Pes1 T C 11: 3,973,330 F168L probably damaging Het
Plch1 C T 3: 63,707,734 R780H possibly damaging Het
Pxdn C G 12: 30,015,505 P1275A probably damaging Het
Sgcz T C 8: 37,526,289 E218G probably damaging Het
Slc27a5 A T 7: 12,991,208 N437K probably damaging Het
Sult2b1 A G 7: 45,735,188 S155P probably damaging Het
Tgfbrap1 T C 1: 43,051,896 M690V probably benign Het
Tmem151a A T 19: 5,083,091 L29Q probably damaging Het
Tmprss2 A G 16: 97,568,437 I379T probably damaging Het
Vmn1r168 T A 7: 23,540,898 V60E probably damaging Het
Vmn2r73 A C 7: 85,858,238 V622G probably benign Het
Wdr72 A G 9: 74,210,646 H880R probably benign Het
Zfhx3 A G 8: 108,951,392 T3025A possibly damaging Het
Other mutations in Nr4a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01362:Nr4a3 APN 4 48051586 missense possibly damaging 0.48
IGL01407:Nr4a3 APN 4 48083201 missense probably benign 0.00
IGL01454:Nr4a3 APN 4 48067803 missense probably damaging 1.00
IGL01472:Nr4a3 APN 4 48071133 missense probably damaging 1.00
IGL02622:Nr4a3 APN 4 48051649 missense probably benign 0.06
IGL03401:Nr4a3 APN 4 48070987 splice site probably null
bulbous UTSW 4 48083255 missense probably damaging 0.98
cronus UTSW 4 48056539 missense probably damaging 1.00
I1329:Nr4a3 UTSW 4 48051585 missense probably benign 0.12
R0486:Nr4a3 UTSW 4 48056525 splice site probably benign
R0610:Nr4a3 UTSW 4 48051903 missense probably benign 0.10
R1170:Nr4a3 UTSW 4 48051564 missense probably damaging 0.98
R1170:Nr4a3 UTSW 4 48083324 missense probably benign 0.01
R1440:Nr4a3 UTSW 4 48051777 missense probably benign
R1977:Nr4a3 UTSW 4 48056539 missense probably damaging 1.00
R2016:Nr4a3 UTSW 4 48083252 missense probably damaging 1.00
R2046:Nr4a3 UTSW 4 48067807 missense possibly damaging 0.82
R2055:Nr4a3 UTSW 4 48067771 missense possibly damaging 0.86
R3707:Nr4a3 UTSW 4 48056699 missense probably damaging 0.99
R3708:Nr4a3 UTSW 4 48056699 missense probably damaging 0.99
R4246:Nr4a3 UTSW 4 48083125 missense possibly damaging 0.86
R4657:Nr4a3 UTSW 4 48051522 missense probably damaging 1.00
R4870:Nr4a3 UTSW 4 48051651 missense possibly damaging 0.73
R5434:Nr4a3 UTSW 4 48067861 missense probably damaging 1.00
R5539:Nr4a3 UTSW 4 48056525 splice site probably null
R5663:Nr4a3 UTSW 4 48055931 missense probably damaging 1.00
R6513:Nr4a3 UTSW 4 48083255 missense probably damaging 0.98
R6664:Nr4a3 UTSW 4 48056006 missense probably damaging 1.00
R6940:Nr4a3 UTSW 4 48051486 missense probably benign 0.04
R7076:Nr4a3 UTSW 4 48055957 missense probably damaging 1.00
R7322:Nr4a3 UTSW 4 48083238 missense probably benign 0.00
R7347:Nr4a3 UTSW 4 48051290 missense possibly damaging 0.94
R7348:Nr4a3 UTSW 4 48051290 missense possibly damaging 0.94
R7349:Nr4a3 UTSW 4 48051290 missense possibly damaging 0.94
R7361:Nr4a3 UTSW 4 48083203 missense probably benign 0.00
R7365:Nr4a3 UTSW 4 48051290 missense possibly damaging 0.94
R7366:Nr4a3 UTSW 4 48051290 missense possibly damaging 0.94
R7418:Nr4a3 UTSW 4 48051476 missense probably damaging 1.00
R7659:Nr4a3 UTSW 4 48051269 missense probably damaging 1.00
R7895:Nr4a3 UTSW 4 48051390 missense probably benign
R7986:Nr4a3 UTSW 4 48055954 missense probably damaging 1.00
R8022:Nr4a3 UTSW 4 48051510 missense probably damaging 1.00
R8226:Nr4a3 UTSW 4 48056588 missense probably damaging 1.00
R8328:Nr4a3 UTSW 4 48051323 missense probably damaging 1.00
R8349:Nr4a3 UTSW 4 48052170 missense probably benign 0.40
R8403:Nr4a3 UTSW 4 48051348 missense probably damaging 1.00
R8449:Nr4a3 UTSW 4 48052170 missense probably benign 0.40
Predicted Primers PCR Primer
(F):5'- AGCCCAGTATAGCCCTTCAC -3'
(R):5'- CTGCTTGAAGTACATGGAGGTGC -3'

Sequencing Primer
(F):5'- CGCAGACTTATGGCTCGGAATAC -3'
(R):5'- TGCTGGGCAGTACCTCGTC -3'
Posted On2018-11-06