Incidental Mutation 'R6921:Invs'
ID539629
Institutional Source Beutler Lab
Gene Symbol Invs
Ensembl Gene ENSMUSG00000028344
Gene Nameinversin
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.705) question?
Stock #R6921 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location48279760-48431954 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 48396260 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 311 (H311R)
Ref Sequence ENSEMBL: ENSMUSP00000030029 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030029] [ENSMUST00000143433]
Predicted Effect possibly damaging
Transcript: ENSMUST00000030029
AA Change: H311R

PolyPhen 2 Score 0.461 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000030029
Gene: ENSMUSG00000028344
AA Change: H311R

DomainStartEndE-ValueType
ANK 47 76 2.66e-5 SMART
ANK 80 110 1.8e-2 SMART
ANK 113 144 1.63e0 SMART
ANK 148 177 6.46e-4 SMART
ANK 181 215 3.44e1 SMART
ANK 220 250 1.11e-2 SMART
ANK 254 285 2.07e-2 SMART
ANK 288 317 3.18e-3 SMART
ANK 321 350 3.91e-3 SMART
ANK 356 385 2.28e-4 SMART
ANK 389 418 8.39e-3 SMART
ANK 422 451 3.76e-5 SMART
ANK 455 484 2.45e-4 SMART
ANK 488 517 1.31e-4 SMART
ANK 523 553 6.71e-2 SMART
IQ 554 576 5.75e-2 SMART
low complexity region 589 607 N/A INTRINSIC
IQ 913 935 2.46e-1 SMART
low complexity region 973 989 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000143433
AA Change: H255R

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000138580
Gene: ENSMUSG00000028344
AA Change: H255R

DomainStartEndE-ValueType
ANK 47 76 2.66e-5 SMART
ANK 80 110 1.8e-2 SMART
ANK 113 144 1.63e0 SMART
ANK 164 194 1.11e-2 SMART
ANK 198 229 2.07e-2 SMART
ANK 232 261 3.18e-3 SMART
ANK 265 294 3.91e-3 SMART
ANK 300 329 2.28e-4 SMART
ANK 333 362 8.39e-3 SMART
ANK 366 395 3.76e-5 SMART
ANK 399 428 2.45e-4 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.8%
  • 10x: 98.9%
  • 20x: 96.4%
Validation Efficiency 96% (46/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing multiple ankyrin domains and two IQ calmodulin-binding domains. The encoded protein may function in renal tubular development and function, and in left-right axis determination. This protein interacts with nephrocystin and infers a connection between primary cilia function and left-right axis determination. A similar protein in mice interacts with calmodulin. Mutations in this gene have been associated with nephronophthisis type 2. Multiple transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, May 2012]
PHENOTYPE: Transgenic mice homozygous for an insertional mutation exhibit complete inversion of the L-R body axis, reversal of embryo turning, complex cardiac anomalies, an abnormally slow turbulent leftward nodal flow, and renal cyst formation. Most succumb to renal failure within 1 week of life. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017B05Rik A T 9: 57,258,736 H118Q probably damaging Het
Adgrl3 T G 5: 81,648,713 V623G probably damaging Het
B9d2 A G 7: 25,686,017 D84G probably damaging Het
Clec1a A T 6: 129,428,864 L268H probably damaging Het
Copa A T 1: 172,111,924 N576I possibly damaging Het
Cyp11b1 T C 15: 74,840,949 T88A probably benign Het
Dis3l2 T C 1: 86,857,341 I318T probably benign Het
Dmtf1 T C 5: 9,130,654 probably benign Het
Dnah17 C A 11: 118,041,484 A3639S probably damaging Het
Dnajc8 T A 4: 132,544,720 I89N probably damaging Het
Dync2h1 T A 9: 7,102,549 H377L probably benign Het
Elmsan1 A G 12: 84,156,459 S890P probably damaging Het
Erfe T A 1: 91,370,332 I212N probably benign Het
Fam117b A G 1: 59,952,935 T248A probably damaging Het
Fbxo10 A T 4: 45,044,849 N595K probably damaging Het
Fzd10 T A 5: 128,601,582 M122K probably damaging Het
Gm4070 G A 7: 105,901,980 Q622* probably null Het
Gpr15 C T 16: 58,717,781 R315H probably benign Het
H6pd T C 4: 149,982,051 D626G probably damaging Het
Hexdc A G 11: 121,222,281 D514G probably damaging Het
Hoxd4 T C 2: 74,728,492 S220P possibly damaging Het
Ip6k1 A G 9: 108,024,435 T70A probably damaging Het
Lipt2 T C 7: 100,160,371 C222R probably damaging Het
Lrrc3 T A 10: 77,901,032 D190V probably damaging Het
March10 T C 11: 105,389,777 T561A probably benign Het
Mcm10 G A 2: 5,000,935 T463I probably benign Het
Mmel1 T C 4: 154,881,677 L52P probably damaging Het
Nipbl T C 15: 8,303,485 N2218S probably benign Het
Nr4a3 C T 4: 48,051,486 P80L probably benign Het
Nrip1 C T 16: 76,292,588 G694R possibly damaging Het
Oit3 A T 10: 59,435,945 C197S probably damaging Het
Olfr1042 C T 2: 86,159,852 V173M probably benign Het
Olfr904 A G 9: 38,464,247 I69V probably benign Het
Otol1 A G 3: 70,028,100 E475G possibly damaging Het
Pes1 T C 11: 3,973,330 F168L probably damaging Het
Plch1 C T 3: 63,707,734 R780H possibly damaging Het
Pxdn C G 12: 30,015,505 P1275A probably damaging Het
Sgcz T C 8: 37,526,289 E218G probably damaging Het
Slc27a5 A T 7: 12,991,208 N437K probably damaging Het
Sult2b1 A G 7: 45,735,188 S155P probably damaging Het
Tgfbrap1 T C 1: 43,051,896 M690V probably benign Het
Tmem151a A T 19: 5,083,091 L29Q probably damaging Het
Tmprss2 A G 16: 97,568,437 I379T probably damaging Het
Vmn1r168 T A 7: 23,540,898 V60E probably damaging Het
Vmn2r73 A C 7: 85,858,238 V622G probably benign Het
Wdr72 A G 9: 74,210,646 H880R probably benign Het
Zfhx3 A G 8: 108,951,392 T3025A possibly damaging Het
Other mutations in Invs
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00428:Invs APN 4 48402909 missense probably damaging 0.98
IGL00487:Invs APN 4 48407689 nonsense probably null
IGL01487:Invs APN 4 48398136 missense probably benign 0.26
IGL01696:Invs APN 4 48425997 missense probably damaging 1.00
IGL02238:Invs APN 4 48390029 missense probably damaging 1.00
IGL03286:Invs APN 4 48382261 missense probably benign 0.26
R0645:Invs UTSW 4 48407653 missense probably benign 0.00
R0661:Invs UTSW 4 48421861 missense probably benign
R0698:Invs UTSW 4 48396364 missense probably benign 0.04
R0763:Invs UTSW 4 48392628 missense possibly damaging 0.82
R1183:Invs UTSW 4 48421725 missense possibly damaging 0.68
R1381:Invs UTSW 4 48421942 nonsense probably null
R1511:Invs UTSW 4 48382148 missense possibly damaging 0.82
R1843:Invs UTSW 4 48422035 missense probably damaging 0.96
R1903:Invs UTSW 4 48402824 splice site probably null
R1928:Invs UTSW 4 48390095 missense probably damaging 1.00
R1990:Invs UTSW 4 48392599 missense possibly damaging 0.88
R2063:Invs UTSW 4 48396287 missense probably damaging 1.00
R2064:Invs UTSW 4 48396287 missense probably damaging 1.00
R2065:Invs UTSW 4 48396287 missense probably damaging 1.00
R2066:Invs UTSW 4 48396287 missense probably damaging 1.00
R4744:Invs UTSW 4 48397609 missense probably damaging 1.00
R4997:Invs UTSW 4 48396332 missense probably damaging 0.98
R5011:Invs UTSW 4 48421807 missense probably damaging 1.00
R5013:Invs UTSW 4 48421807 missense probably damaging 1.00
R5083:Invs UTSW 4 48396307 missense possibly damaging 0.90
R5184:Invs UTSW 4 48283242 utr 5 prime probably benign
R5258:Invs UTSW 4 48396374 missense possibly damaging 0.82
R5375:Invs UTSW 4 48385262 missense probably benign 0.12
R5509:Invs UTSW 4 48396337 missense probably damaging 1.00
R5560:Invs UTSW 4 48416084 missense probably benign 0.00
R5748:Invs UTSW 4 48307823 missense probably damaging 0.98
R5813:Invs UTSW 4 48398146 missense probably damaging 0.98
R5840:Invs UTSW 4 48396284 missense probably damaging 1.00
R5984:Invs UTSW 4 48421674 missense probably benign 0.00
R6513:Invs UTSW 4 48397534 missense possibly damaging 0.46
R6637:Invs UTSW 4 48416203 splice site probably null
R6667:Invs UTSW 4 48402870 missense possibly damaging 0.66
R6838:Invs UTSW 4 48283278 missense possibly damaging 0.95
R6945:Invs UTSW 4 48421785 missense probably benign 0.00
R7102:Invs UTSW 4 48407674 missense probably benign 0.21
R7142:Invs UTSW 4 48407696 missense probably damaging 1.00
R7263:Invs UTSW 4 48396381 missense probably damaging 1.00
R7283:Invs UTSW 4 48392526 intron probably null
R7461:Invs UTSW 4 48392668 missense probably damaging 1.00
R7503:Invs UTSW 4 48396347 missense probably damaging 0.96
R7581:Invs UTSW 4 48421909 missense probably benign 0.00
R7613:Invs UTSW 4 48392668 missense probably damaging 1.00
R7861:Invs UTSW 4 48397559 missense possibly damaging 0.50
R7944:Invs UTSW 4 48397559 missense possibly damaging 0.50
X0026:Invs UTSW 4 48398221 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- CCAAATGTAATGGTGTTGCATGAG -3'
(R):5'- AAGCACCATGAGCCCATGTG -3'

Sequencing Primer
(F):5'- TGTTCTTGAAGTGTTCCAGAAAC -3'
(R):5'- ATGAGCCCATGTGCCAGTTC -3'
Posted On2018-11-06