Incidental Mutation 'R6921:Dnajc8'
ID539630
Institutional Source Beutler Lab
Gene Symbol Dnajc8
Ensembl Gene ENSMUSG00000054405
Gene NameDnaJ heat shock protein family (Hsp40) member C8
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6921 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location132535550-132553742 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 132544720 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 89 (I89N)
Ref Sequence ENSEMBL: ENSMUSP00000101559 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067467] [ENSMUST00000094657] [ENSMUST00000105939] [ENSMUST00000105940] [ENSMUST00000138334] [ENSMUST00000139074] [ENSMUST00000144073]
Predicted Effect probably benign
Transcript: ENSMUST00000067467
SMART Domains Protein: ENSMUSP00000068069
Gene: ENSMUSG00000054405

DomainStartEndE-ValueType
low complexity region 2 19 N/A INTRINSIC
SCOP:d1repc1 23 79 4e-5 SMART
Blast:DnaJ 56 79 6e-9 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000094657
AA Change: I123N

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000092242
Gene: ENSMUSG00000054405
AA Change: I123N

DomainStartEndE-ValueType
low complexity region 2 19 N/A INTRINSIC
DnaJ 56 115 2.65e-18 SMART
low complexity region 135 146 N/A INTRINSIC
coiled coil region 164 210 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000105939
AA Change: I89N

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000101559
Gene: ENSMUSG00000054405
AA Change: I89N

DomainStartEndE-ValueType
low complexity region 2 19 N/A INTRINSIC
DnaJ 22 81 2.09e-16 SMART
low complexity region 101 112 N/A INTRINSIC
coiled coil region 130 176 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000105940
AA Change: I104N

PolyPhen 2 Score 0.938 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000101560
Gene: ENSMUSG00000054405
AA Change: I104N

DomainStartEndE-ValueType
low complexity region 2 19 N/A INTRINSIC
DnaJ 56 96 2.15e-1 SMART
low complexity region 116 127 N/A INTRINSIC
coiled coil region 145 191 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000138334
SMART Domains Protein: ENSMUSP00000130135
Gene: ENSMUSG00000054405

DomainStartEndE-ValueType
DnaJ 38 84 4.42e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000139074
Predicted Effect probably benign
Transcript: ENSMUST00000144073
SMART Domains Protein: ENSMUSP00000131575
Gene: ENSMUSG00000054405

DomainStartEndE-ValueType
low complexity region 2 19 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000121009
Gene: ENSMUSG00000054405
AA Change: I98N

DomainStartEndE-ValueType
DnaJ 32 91 2.65e-18 SMART
low complexity region 111 122 N/A INTRINSIC
low complexity region 178 190 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000156385
SMART Domains Protein: ENSMUSP00000125885
Gene: ENSMUSG00000054405

DomainStartEndE-ValueType
coiled coil region 23 69 N/A INTRINSIC
Meta Mutation Damage Score 0.3519 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.8%
  • 10x: 98.9%
  • 20x: 96.4%
Validation Efficiency 96% (46/48)
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017B05Rik A T 9: 57,258,736 H118Q probably damaging Het
Adgrl3 T G 5: 81,648,713 V623G probably damaging Het
B9d2 A G 7: 25,686,017 D84G probably damaging Het
Clec1a A T 6: 129,428,864 L268H probably damaging Het
Copa A T 1: 172,111,924 N576I possibly damaging Het
Cyp11b1 T C 15: 74,840,949 T88A probably benign Het
Dis3l2 T C 1: 86,857,341 I318T probably benign Het
Dmtf1 T C 5: 9,130,654 probably benign Het
Dnah17 C A 11: 118,041,484 A3639S probably damaging Het
Dync2h1 T A 9: 7,102,549 H377L probably benign Het
Elmsan1 A G 12: 84,156,459 S890P probably damaging Het
Erfe T A 1: 91,370,332 I212N probably benign Het
Fam117b A G 1: 59,952,935 T248A probably damaging Het
Fbxo10 A T 4: 45,044,849 N595K probably damaging Het
Fzd10 T A 5: 128,601,582 M122K probably damaging Het
Gm4070 G A 7: 105,901,980 Q622* probably null Het
Gpr15 C T 16: 58,717,781 R315H probably benign Het
H6pd T C 4: 149,982,051 D626G probably damaging Het
Hexdc A G 11: 121,222,281 D514G probably damaging Het
Hoxd4 T C 2: 74,728,492 S220P possibly damaging Het
Invs A G 4: 48,396,260 H311R possibly damaging Het
Ip6k1 A G 9: 108,024,435 T70A probably damaging Het
Lipt2 T C 7: 100,160,371 C222R probably damaging Het
Lrrc3 T A 10: 77,901,032 D190V probably damaging Het
March10 T C 11: 105,389,777 T561A probably benign Het
Mcm10 G A 2: 5,000,935 T463I probably benign Het
Mmel1 T C 4: 154,881,677 L52P probably damaging Het
Nipbl T C 15: 8,303,485 N2218S probably benign Het
Nr4a3 C T 4: 48,051,486 P80L probably benign Het
Nrip1 C T 16: 76,292,588 G694R possibly damaging Het
Oit3 A T 10: 59,435,945 C197S probably damaging Het
Olfr1042 C T 2: 86,159,852 V173M probably benign Het
Olfr904 A G 9: 38,464,247 I69V probably benign Het
Otol1 A G 3: 70,028,100 E475G possibly damaging Het
Pes1 T C 11: 3,973,330 F168L probably damaging Het
Plch1 C T 3: 63,707,734 R780H possibly damaging Het
Pxdn C G 12: 30,015,505 P1275A probably damaging Het
Sgcz T C 8: 37,526,289 E218G probably damaging Het
Slc27a5 A T 7: 12,991,208 N437K probably damaging Het
Sult2b1 A G 7: 45,735,188 S155P probably damaging Het
Tgfbrap1 T C 1: 43,051,896 M690V probably benign Het
Tmem151a A T 19: 5,083,091 L29Q probably damaging Het
Tmprss2 A G 16: 97,568,437 I379T probably damaging Het
Vmn1r168 T A 7: 23,540,898 V60E probably damaging Het
Vmn2r73 A C 7: 85,858,238 V622G probably benign Het
Wdr72 A G 9: 74,210,646 H880R probably benign Het
Zfhx3 A G 8: 108,951,392 T3025A possibly damaging Het
Other mutations in Dnajc8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03211:Dnajc8 APN 4 132544737 missense possibly damaging 0.95
pith UTSW 4 132544720 missense probably damaging 0.98
R2130:Dnajc8 UTSW 4 132544059 missense possibly damaging 0.95
R3077:Dnajc8 UTSW 4 132544663 missense probably damaging 1.00
R5621:Dnajc8 UTSW 4 132553252 unclassified probably benign
R6925:Dnajc8 UTSW 4 132544113 missense probably damaging 0.99
R7255:Dnajc8 UTSW 4 132551573 missense probably benign 0.20
R8054:Dnajc8 UTSW 4 132544757 unclassified probably benign
R8243:Dnajc8 UTSW 4 132551464 splice site probably null
Predicted Primers PCR Primer
(F):5'- CAAGGTCATTGCTATGGTTGTATGC -3'
(R):5'- TTTGGGCACTCTTCCTGAGC -3'

Sequencing Primer
(F):5'- AGCTCAGACTTTGAGAGG -3'
(R):5'- TCTTCCTGAGCAGCACAGC -3'
Posted On2018-11-06