Incidental Mutation 'R6921:Ip6k1'
ID539649
Institutional Source Beutler Lab
Gene Symbol Ip6k1
Ensembl Gene ENSMUSG00000032594
Gene Nameinositol hexaphosphate kinase 1
Synonyms1200016D08Rik, InsP6, Ihpk1, InsP6k1
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.357) question?
Stock #R6921 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location108002501-108048782 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 108024435 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 70 (T70A)
Ref Sequence ENSEMBL: ENSMUSP00000135747 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035214] [ENSMUST00000164395] [ENSMUST00000175874] [ENSMUST00000176356] [ENSMUST00000176566] [ENSMUST00000176854]
Predicted Effect probably damaging
Transcript: ENSMUST00000035214
AA Change: T70A

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000035214
Gene: ENSMUSG00000032594
AA Change: T70A

DomainStartEndE-ValueType
low complexity region 114 129 N/A INTRINSIC
Pfam:IPK 207 426 2.2e-67 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000164395
AA Change: T70A

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000175874
AA Change: T70A

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000135747
Gene: ENSMUSG00000032594
AA Change: T70A

DomainStartEndE-ValueType
low complexity region 114 129 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176356
Predicted Effect probably benign
Transcript: ENSMUST00000176459
Predicted Effect probably benign
Transcript: ENSMUST00000176566
Predicted Effect possibly damaging
Transcript: ENSMUST00000176854
AA Change: T70A

PolyPhen 2 Score 0.952 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000141232
Gene: ENSMUSG00000032594
AA Change: T70A

DomainStartEndE-ValueType
low complexity region 114 129 N/A INTRINSIC
Meta Mutation Damage Score 0.0915 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.8%
  • 10x: 98.9%
  • 20x: 96.4%
Validation Efficiency 96% (46/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the inositol phosphokinase family. The encoded protein may be responsible for the conversion of inositol hexakisphosphate (InsP6) to diphosphoinositol pentakisphosphate (InsP7/PP-InsP5). It may also convert 1,3,4,5,6-pentakisphosphate (InsP5) to PP-InsP4. Alternatively spliced transcript variants have been described. [provided by RefSeq, Jun 2011]
PHENOTYPE: Homozygous mutation of this gene results in impaired glucose tolerance, decreased insulin levels, bilateral epididymal aspermia, and testicular degeneration in males. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017B05Rik A T 9: 57,258,736 H118Q probably damaging Het
Adgrl3 T G 5: 81,648,713 V623G probably damaging Het
B9d2 A G 7: 25,686,017 D84G probably damaging Het
Clec1a A T 6: 129,428,864 L268H probably damaging Het
Copa A T 1: 172,111,924 N576I possibly damaging Het
Cyp11b1 T C 15: 74,840,949 T88A probably benign Het
Dis3l2 T C 1: 86,857,341 I318T probably benign Het
Dmtf1 T C 5: 9,130,654 probably benign Het
Dnah17 C A 11: 118,041,484 A3639S probably damaging Het
Dnajc8 T A 4: 132,544,720 I89N probably damaging Het
Dync2h1 T A 9: 7,102,549 H377L probably benign Het
Elmsan1 A G 12: 84,156,459 S890P probably damaging Het
Erfe T A 1: 91,370,332 I212N probably benign Het
Fam117b A G 1: 59,952,935 T248A probably damaging Het
Fbxo10 A T 4: 45,044,849 N595K probably damaging Het
Fzd10 T A 5: 128,601,582 M122K probably damaging Het
Gm4070 G A 7: 105,901,980 Q622* probably null Het
Gpr15 C T 16: 58,717,781 R315H probably benign Het
H6pd T C 4: 149,982,051 D626G probably damaging Het
Hexdc A G 11: 121,222,281 D514G probably damaging Het
Hoxd4 T C 2: 74,728,492 S220P possibly damaging Het
Invs A G 4: 48,396,260 H311R possibly damaging Het
Lipt2 T C 7: 100,160,371 C222R probably damaging Het
Lrrc3 T A 10: 77,901,032 D190V probably damaging Het
March10 T C 11: 105,389,777 T561A probably benign Het
Mcm10 G A 2: 5,000,935 T463I probably benign Het
Mmel1 T C 4: 154,881,677 L52P probably damaging Het
Nipbl T C 15: 8,303,485 N2218S probably benign Het
Nr4a3 C T 4: 48,051,486 P80L probably benign Het
Nrip1 C T 16: 76,292,588 G694R possibly damaging Het
Oit3 A T 10: 59,435,945 C197S probably damaging Het
Olfr1042 C T 2: 86,159,852 V173M probably benign Het
Olfr904 A G 9: 38,464,247 I69V probably benign Het
Otol1 A G 3: 70,028,100 E475G possibly damaging Het
Pes1 T C 11: 3,973,330 F168L probably damaging Het
Plch1 C T 3: 63,707,734 R780H possibly damaging Het
Pxdn C G 12: 30,015,505 P1275A probably damaging Het
Sgcz T C 8: 37,526,289 E218G probably damaging Het
Slc27a5 A T 7: 12,991,208 N437K probably damaging Het
Sult2b1 A G 7: 45,735,188 S155P probably damaging Het
Tgfbrap1 T C 1: 43,051,896 M690V probably benign Het
Tmem151a A T 19: 5,083,091 L29Q probably damaging Het
Tmprss2 A G 16: 97,568,437 I379T probably damaging Het
Vmn1r168 T A 7: 23,540,898 V60E probably damaging Het
Vmn2r73 A C 7: 85,858,238 V622G probably benign Het
Wdr72 A G 9: 74,210,646 H880R probably benign Het
Zfhx3 A G 8: 108,951,392 T3025A possibly damaging Het
Other mutations in Ip6k1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01286:Ip6k1 APN 9 108045883 missense probably benign 0.01
R0147:Ip6k1 UTSW 9 108045894 missense probably damaging 1.00
R1371:Ip6k1 UTSW 9 108045823 missense probably damaging 0.96
R1530:Ip6k1 UTSW 9 108045562 nonsense probably null
R1716:Ip6k1 UTSW 9 108040996 missense possibly damaging 0.89
R1717:Ip6k1 UTSW 9 108040996 missense possibly damaging 0.89
R1718:Ip6k1 UTSW 9 108040996 missense possibly damaging 0.89
R1719:Ip6k1 UTSW 9 108040996 missense possibly damaging 0.89
R1741:Ip6k1 UTSW 9 108040984 missense probably benign 0.43
R1745:Ip6k1 UTSW 9 108040996 missense possibly damaging 0.89
R1747:Ip6k1 UTSW 9 108040996 missense possibly damaging 0.89
R1901:Ip6k1 UTSW 9 108040996 missense possibly damaging 0.89
R1902:Ip6k1 UTSW 9 108040996 missense possibly damaging 0.89
R1903:Ip6k1 UTSW 9 108040996 missense possibly damaging 0.89
R1962:Ip6k1 UTSW 9 108041088 critical splice donor site probably null
R2126:Ip6k1 UTSW 9 108040996 missense possibly damaging 0.89
R3809:Ip6k1 UTSW 9 108045887 missense probably damaging 1.00
R5000:Ip6k1 UTSW 9 108045599 nonsense probably null
R6074:Ip6k1 UTSW 9 108024109 utr 5 prime probably benign
R7069:Ip6k1 UTSW 9 108045452 splice site probably null
R7154:Ip6k1 UTSW 9 108045662 missense probably damaging 1.00
R7218:Ip6k1 UTSW 9 108045582 missense unknown
R7330:Ip6k1 UTSW 9 108045253 missense possibly damaging 0.56
R7731:Ip6k1 UTSW 9 108044728 missense probably damaging 1.00
X0021:Ip6k1 UTSW 9 108032190 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCAAACCATGGAAGTGGGGC -3'
(R):5'- GGACAATAGGCTTTTCTCCACC -3'

Sequencing Primer
(F):5'- CCATGGAAGTGGGGCAGTATG -3'
(R):5'- TGGGTCTACCTAATGTCAATTTTTC -3'
Posted On2018-11-06