Incidental Mutation 'R6921:Oit3'
ID 539650
Institutional Source Beutler Lab
Gene Symbol Oit3
Ensembl Gene ENSMUSG00000009654
Gene Name oncoprotein induced transcript 3
Synonyms EF-9
MMRRC Submission 045006-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.378) question?
Stock # R6921 (G1)
Quality Score 225.009
Status Validated
Chromosome 10
Chromosomal Location 59422958-59441778 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 59435945 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Cysteine to Serine at position 197 (C197S)
Ref Sequence ENSEMBL: ENSMUSP00000009798 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000009798]
AlphaFold Q8R4V5
Predicted Effect probably damaging
Transcript: ENSMUST00000009798
AA Change: C197S

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000009798
Gene: ENSMUSG00000009654
AA Change: C197S

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Blast:ZP 50 144 9e-24 BLAST
EGF 150 181 2.16e1 SMART
EGF 185 222 2.94e-3 SMART
EGF 226 263 2.35e-2 SMART
ZP 267 516 2.74e-30 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.8%
  • 10x: 98.9%
  • 20x: 96.4%
Validation Efficiency 96% (46/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene was identified due to its downregulation in hepatocarcinomas. The encoded protein may be involved in liver development and function. [provided by RefSeq, Sep 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased bloord uric acid, increased urine uric acid and polyuria. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017B05Rik A T 9: 57,258,736 (GRCm38) H118Q probably damaging Het
Adgrl3 T G 5: 81,648,713 (GRCm38) V623G probably damaging Het
B9d2 A G 7: 25,686,017 (GRCm38) D84G probably damaging Het
Clec1a A T 6: 129,428,864 (GRCm38) L268H probably damaging Het
Copa A T 1: 172,111,924 (GRCm38) N576I possibly damaging Het
Cyp11b1 T C 15: 74,840,949 (GRCm38) T88A probably benign Het
Dis3l2 T C 1: 86,857,341 (GRCm38) I318T probably benign Het
Dmtf1 T C 5: 9,130,654 (GRCm38) probably benign Het
Dnah17 C A 11: 118,041,484 (GRCm38) A3639S probably damaging Het
Dnajc8 T A 4: 132,544,720 (GRCm38) I89N probably damaging Het
Dync2h1 T A 9: 7,102,549 (GRCm38) H377L probably benign Het
Elmsan1 A G 12: 84,156,459 (GRCm38) S890P probably damaging Het
Erfe T A 1: 91,370,332 (GRCm38) I212N probably benign Het
Fam117b A G 1: 59,952,935 (GRCm38) T248A probably damaging Het
Fbxo10 A T 4: 45,044,849 (GRCm38) N595K probably damaging Het
Fzd10 T A 5: 128,601,582 (GRCm38) M122K probably damaging Het
Gm4070 G A 7: 105,901,980 (GRCm38) Q622* probably null Het
Gpr15 C T 16: 58,717,781 (GRCm38) R315H probably benign Het
H6pd T C 4: 149,982,051 (GRCm38) D626G probably damaging Het
Hexdc A G 11: 121,222,281 (GRCm38) D514G probably damaging Het
Hoxd4 T C 2: 74,728,492 (GRCm38) S220P possibly damaging Het
Invs A G 4: 48,396,260 (GRCm38) H311R possibly damaging Het
Ip6k1 A G 9: 108,024,435 (GRCm38) T70A probably damaging Het
Lipt2 T C 7: 100,160,371 (GRCm38) C222R probably damaging Het
Lrrc3 T A 10: 77,901,032 (GRCm38) D190V probably damaging Het
March10 T C 11: 105,389,777 (GRCm38) T561A probably benign Het
Mcm10 G A 2: 5,000,935 (GRCm38) T463I probably benign Het
Mmel1 T C 4: 154,881,677 (GRCm38) L52P probably damaging Het
Nipbl T C 15: 8,303,485 (GRCm38) N2218S probably benign Het
Nr4a3 C T 4: 48,051,486 (GRCm38) P80L probably benign Het
Nrip1 C T 16: 76,292,588 (GRCm38) G694R possibly damaging Het
Olfr1042 C T 2: 86,159,852 (GRCm38) V173M probably benign Het
Olfr904 A G 9: 38,464,247 (GRCm38) I69V probably benign Het
Otol1 A G 3: 70,028,100 (GRCm38) E475G possibly damaging Het
Pes1 T C 11: 3,973,330 (GRCm38) F168L probably damaging Het
Plch1 C T 3: 63,707,734 (GRCm38) R780H possibly damaging Het
Pxdn C G 12: 30,015,505 (GRCm38) P1275A probably damaging Het
Sgcz T C 8: 37,526,289 (GRCm38) E218G probably damaging Het
Slc27a5 A T 7: 12,991,208 (GRCm38) N437K probably damaging Het
Sult2b1 A G 7: 45,735,188 (GRCm38) S155P probably damaging Het
Tgfbrap1 T C 1: 43,051,896 (GRCm38) M690V probably benign Het
Tmem151a A T 19: 5,083,091 (GRCm38) L29Q probably damaging Het
Tmprss2 A G 16: 97,568,437 (GRCm38) I379T probably damaging Het
Vmn1r168 T A 7: 23,540,898 (GRCm38) V60E probably damaging Het
Vmn2r73 A C 7: 85,858,238 (GRCm38) V622G probably benign Het
Wdr72 A G 9: 74,210,646 (GRCm38) H880R probably benign Het
Zfhx3 A G 8: 108,951,392 (GRCm38) T3025A possibly damaging Het
Other mutations in Oit3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01457:Oit3 APN 10 59,425,484 (GRCm38) unclassified probably benign
IGL01665:Oit3 APN 10 59,438,909 (GRCm38) missense probably damaging 1.00
IGL01839:Oit3 APN 10 59,429,496 (GRCm38) missense probably damaging 0.98
IGL02028:Oit3 APN 10 59,438,655 (GRCm38) missense probably damaging 0.98
PIT4585001:Oit3 UTSW 10 59,431,013 (GRCm38) missense possibly damaging 0.54
R0567:Oit3 UTSW 10 59,435,978 (GRCm38) missense probably damaging 0.99
R0781:Oit3 UTSW 10 59,428,194 (GRCm38) missense probably damaging 1.00
R1110:Oit3 UTSW 10 59,428,194 (GRCm38) missense probably damaging 1.00
R1563:Oit3 UTSW 10 59,428,074 (GRCm38) missense probably damaging 1.00
R1623:Oit3 UTSW 10 59,428,239 (GRCm38) missense probably damaging 0.99
R1693:Oit3 UTSW 10 59,425,417 (GRCm38) missense probably damaging 1.00
R1754:Oit3 UTSW 10 59,427,940 (GRCm38) splice site probably null
R1853:Oit3 UTSW 10 59,441,622 (GRCm38) critical splice donor site probably null
R2070:Oit3 UTSW 10 59,431,013 (GRCm38) missense probably benign 0.03
R2211:Oit3 UTSW 10 59,428,070 (GRCm38) missense probably damaging 1.00
R2516:Oit3 UTSW 10 59,441,685 (GRCm38) start gained probably benign
R2516:Oit3 UTSW 10 59,428,345 (GRCm38) missense probably damaging 1.00
R3103:Oit3 UTSW 10 59,438,891 (GRCm38) missense probably damaging 0.98
R4414:Oit3 UTSW 10 59,428,103 (GRCm38) missense probably damaging 1.00
R4415:Oit3 UTSW 10 59,428,103 (GRCm38) missense probably damaging 1.00
R4416:Oit3 UTSW 10 59,428,103 (GRCm38) missense probably damaging 1.00
R4417:Oit3 UTSW 10 59,428,103 (GRCm38) missense probably damaging 1.00
R4584:Oit3 UTSW 10 59,425,462 (GRCm38) missense probably damaging 1.00
R4734:Oit3 UTSW 10 59,424,082 (GRCm38) missense probably damaging 0.99
R4748:Oit3 UTSW 10 59,424,082 (GRCm38) missense probably damaging 0.99
R4749:Oit3 UTSW 10 59,424,082 (GRCm38) missense probably damaging 0.99
R5070:Oit3 UTSW 10 59,424,027 (GRCm38) missense probably damaging 1.00
R5521:Oit3 UTSW 10 59,435,914 (GRCm38) missense probably benign
R6326:Oit3 UTSW 10 59,428,239 (GRCm38) missense probably damaging 1.00
R6490:Oit3 UTSW 10 59,438,552 (GRCm38) missense possibly damaging 0.92
R6526:Oit3 UTSW 10 59,429,640 (GRCm38) missense probably damaging 1.00
R6766:Oit3 UTSW 10 59,438,712 (GRCm38) missense probably damaging 0.99
R7129:Oit3 UTSW 10 59,428,344 (GRCm38) missense probably damaging 0.99
R7440:Oit3 UTSW 10 59,429,570 (GRCm38) missense probably damaging 0.99
R7495:Oit3 UTSW 10 59,423,943 (GRCm38) missense possibly damaging 0.74
R7512:Oit3 UTSW 10 59,438,894 (GRCm38) missense probably damaging 1.00
R7866:Oit3 UTSW 10 59,424,030 (GRCm38) missense probably benign 0.03
R8312:Oit3 UTSW 10 59,438,810 (GRCm38) missense probably benign 0.01
R8321:Oit3 UTSW 10 59,428,160 (GRCm38) missense probably benign 0.00
R8919:Oit3 UTSW 10 59,441,646 (GRCm38) missense unknown
R9131:Oit3 UTSW 10 59,435,929 (GRCm38) missense probably benign 0.01
R9457:Oit3 UTSW 10 59,441,683 (GRCm38) start codon destroyed unknown
R9478:Oit3 UTSW 10 59,438,642 (GRCm38) missense probably damaging 0.99
R9502:Oit3 UTSW 10 59,428,351 (GRCm38) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTGAATTCTGTCCACAGCTTAAGC -3'
(R):5'- ACTACGCTGGCTCATACACG -3'

Sequencing Primer
(F):5'- GTAGCCATTTCCTTAGGCTGACAAAC -3'
(R):5'- TACGCTGGCTCATACACGATAGG -3'
Posted On 2018-11-06