Incidental Mutation 'R6921:Pxdn'
ID539656
Institutional Source Beutler Lab
Gene Symbol Pxdn
Ensembl Gene ENSMUSG00000020674
Gene Nameperoxidasin
SynonymsVPO1, 2310075M15Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.600) question?
Stock #R6921 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location29937608-30017658 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 30015505 bp
ZygosityHeterozygous
Amino Acid Change Proline to Alanine at position 1275 (P1275A)
Ref Sequence ENSEMBL: ENSMUSP00000151320 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000122328] [ENSMUST00000220271]
Predicted Effect probably damaging
Transcript: ENSMUST00000122328
AA Change: P1455A

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000113703
Gene: ENSMUSG00000020674
AA Change: P1455A

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
LRRNT 32 63 2.52e-1 SMART
LRR 62 81 4.09e1 SMART
LRR_TYP 82 105 3.69e-4 SMART
LRR_TYP 106 129 1.45e-2 SMART
LRR_TYP 130 153 8.02e-5 SMART
LRR_TYP 154 177 1.06e-4 SMART
LRRCT 189 241 3.97e-5 SMART
IGc2 255 321 1.59e-15 SMART
IGc2 351 416 3.96e-16 SMART
IGc2 442 506 2.96e-15 SMART
IGc2 534 598 1.2e-15 SMART
Pfam:An_peroxidase 738 1286 1.1e-196 PFAM
VWC 1411 1466 8.8e-15 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000220271
AA Change: P1275A

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.8%
  • 10x: 98.9%
  • 20x: 96.4%
Validation Efficiency 96% (46/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a heme-containing peroxidase that is secreted into the extracellular matrix. It is involved in extracellular matrix formation, and may function in the physiological and pathological fibrogenic response in fibrotic kidney. Mutations in this gene cause corneal opacification and other ocular anomalies, and also microphthalmia and anterior segment dysgenesis. [provided by RefSeq, Aug 2014]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit abnormal eye development with early-onset glaucoma and progressive retinal dysgenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017B05Rik A T 9: 57,258,736 H118Q probably damaging Het
Adgrl3 T G 5: 81,648,713 V623G probably damaging Het
B9d2 A G 7: 25,686,017 D84G probably damaging Het
Clec1a A T 6: 129,428,864 L268H probably damaging Het
Copa A T 1: 172,111,924 N576I possibly damaging Het
Cyp11b1 T C 15: 74,840,949 T88A probably benign Het
Dis3l2 T C 1: 86,857,341 I318T probably benign Het
Dmtf1 T C 5: 9,130,654 probably benign Het
Dnah17 C A 11: 118,041,484 A3639S probably damaging Het
Dnajc8 T A 4: 132,544,720 I89N probably damaging Het
Dync2h1 T A 9: 7,102,549 H377L probably benign Het
Elmsan1 A G 12: 84,156,459 S890P probably damaging Het
Erfe T A 1: 91,370,332 I212N probably benign Het
Fam117b A G 1: 59,952,935 T248A probably damaging Het
Fbxo10 A T 4: 45,044,849 N595K probably damaging Het
Fzd10 T A 5: 128,601,582 M122K probably damaging Het
Gm4070 G A 7: 105,901,980 Q622* probably null Het
Gpr15 C T 16: 58,717,781 R315H probably benign Het
H6pd T C 4: 149,982,051 D626G probably damaging Het
Hexdc A G 11: 121,222,281 D514G probably damaging Het
Hoxd4 T C 2: 74,728,492 S220P possibly damaging Het
Invs A G 4: 48,396,260 H311R possibly damaging Het
Ip6k1 A G 9: 108,024,435 T70A probably damaging Het
Lipt2 T C 7: 100,160,371 C222R probably damaging Het
Lrrc3 T A 10: 77,901,032 D190V probably damaging Het
March10 T C 11: 105,389,777 T561A probably benign Het
Mcm10 G A 2: 5,000,935 T463I probably benign Het
Mmel1 T C 4: 154,881,677 L52P probably damaging Het
Nipbl T C 15: 8,303,485 N2218S probably benign Het
Nr4a3 C T 4: 48,051,486 P80L probably benign Het
Nrip1 C T 16: 76,292,588 G694R possibly damaging Het
Oit3 A T 10: 59,435,945 C197S probably damaging Het
Olfr1042 C T 2: 86,159,852 V173M probably benign Het
Olfr904 A G 9: 38,464,247 I69V probably benign Het
Otol1 A G 3: 70,028,100 E475G possibly damaging Het
Pes1 T C 11: 3,973,330 F168L probably damaging Het
Plch1 C T 3: 63,707,734 R780H possibly damaging Het
Sgcz T C 8: 37,526,289 E218G probably damaging Het
Slc27a5 A T 7: 12,991,208 N437K probably damaging Het
Sult2b1 A G 7: 45,735,188 S155P probably damaging Het
Tgfbrap1 T C 1: 43,051,896 M690V probably benign Het
Tmem151a A T 19: 5,083,091 L29Q probably damaging Het
Tmprss2 A G 16: 97,568,437 I379T probably damaging Het
Vmn1r168 T A 7: 23,540,898 V60E probably damaging Het
Vmn2r73 A C 7: 85,858,238 V622G probably benign Het
Wdr72 A G 9: 74,210,646 H880R probably benign Het
Zfhx3 A G 8: 108,951,392 T3025A possibly damaging Het
Other mutations in Pxdn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01024:Pxdn APN 12 29987099 missense probably damaging 1.00
IGL01152:Pxdn APN 12 30001937 missense probably damaging 0.99
IGL01286:Pxdn APN 12 29982754 missense probably benign 0.04
IGL01323:Pxdn APN 12 29987137 missense probably benign 0.00
IGL01338:Pxdn APN 12 30002797 missense probably damaging 1.00
IGL01341:Pxdn APN 12 30002487 missense probably damaging 1.00
IGL01401:Pxdn APN 12 30001984 missense probably damaging 1.00
IGL01580:Pxdn APN 12 29984493 missense probably benign 0.18
IGL01650:Pxdn APN 12 30002401 missense probably benign 0.01
IGL01679:Pxdn APN 12 29999902 missense probably damaging 0.97
IGL01866:Pxdn APN 12 29984571 missense probably benign 0.02
IGL02354:Pxdn APN 12 29999189 missense probably damaging 1.00
IGL02361:Pxdn APN 12 29999189 missense probably damaging 1.00
IGL02427:Pxdn APN 12 29984532 missense probably damaging 1.00
IGL02955:Pxdn APN 12 30003157 missense probably damaging 1.00
IGL03079:Pxdn APN 12 30002998 missense probably damaging 0.97
IGL03111:Pxdn APN 12 29982756 missense probably damaging 0.99
IGL02988:Pxdn UTSW 12 30003114 nonsense probably null
PIT4280001:Pxdn UTSW 12 29995328 missense probably damaging 0.99
PIT4469001:Pxdn UTSW 12 30005829 missense probably benign 0.00
R0070:Pxdn UTSW 12 29982727 missense probably damaging 0.99
R0070:Pxdn UTSW 12 29982727 missense probably damaging 0.99
R0086:Pxdn UTSW 12 30002419 missense possibly damaging 0.95
R0140:Pxdn UTSW 12 29982754 missense probably benign 0.04
R0201:Pxdn UTSW 12 30002431 missense possibly damaging 0.79
R0282:Pxdn UTSW 12 29984440 nonsense probably null
R0310:Pxdn UTSW 12 30015529 missense probably damaging 1.00
R0426:Pxdn UTSW 12 29987066 missense possibly damaging 0.89
R0468:Pxdn UTSW 12 29994486 missense probably damaging 0.99
R0825:Pxdn UTSW 12 29984996 splice site probably benign
R0885:Pxdn UTSW 12 30003402 missense probably benign 0.30
R1420:Pxdn UTSW 12 30002068 missense probably damaging 1.00
R1588:Pxdn UTSW 12 30002559 missense probably damaging 1.00
R2269:Pxdn UTSW 12 30005775 missense probably damaging 0.97
R2280:Pxdn UTSW 12 29984906 missense probably damaging 0.98
R2504:Pxdn UTSW 12 30003406 missense probably damaging 1.00
R2679:Pxdn UTSW 12 29975569 splice site probably benign
R3116:Pxdn UTSW 12 30002307 missense possibly damaging 0.89
R3607:Pxdn UTSW 12 29990918 missense probably benign 0.04
R4033:Pxdn UTSW 12 30003225 missense probably benign 0.19
R4576:Pxdn UTSW 12 30011923 missense probably benign
R4659:Pxdn UTSW 12 29994553 missense probably benign 0.01
R4681:Pxdn UTSW 12 30012326 missense probably benign 0.45
R4968:Pxdn UTSW 12 30000012 missense probably benign 0.25
R5032:Pxdn UTSW 12 30003141 missense probably benign 0.08
R5232:Pxdn UTSW 12 29990988 missense probably benign 0.08
R5366:Pxdn UTSW 12 30002900 missense probably damaging 1.00
R5504:Pxdn UTSW 12 30002801 missense probably damaging 1.00
R5586:Pxdn UTSW 12 30003142 missense probably damaging 0.99
R5739:Pxdn UTSW 12 29982334 missense probably benign 0.03
R5877:Pxdn UTSW 12 30003046 missense probably damaging 1.00
R6167:Pxdn UTSW 12 29974001 missense probably damaging 1.00
R6191:Pxdn UTSW 12 29982717 missense possibly damaging 0.94
R6200:Pxdn UTSW 12 30003112 missense probably damaging 1.00
R6609:Pxdn UTSW 12 30002941 missense probably benign 0.00
R6628:Pxdn UTSW 12 29999918 missense probably damaging 1.00
R6865:Pxdn UTSW 12 30014583 splice site probably null
R6995:Pxdn UTSW 12 29995371 missense possibly damaging 0.95
R7211:Pxdn UTSW 12 29984904 missense possibly damaging 0.77
R7220:Pxdn UTSW 12 29994480 missense probably benign 0.02
R7347:Pxdn UTSW 12 30012261 missense probably benign 0.01
R7402:Pxdn UTSW 12 30002439 missense probably damaging 1.00
R7408:Pxdn UTSW 12 29990945 missense probably benign 0.29
R7413:Pxdn UTSW 12 30002928 missense probably benign 0.00
R7447:Pxdn UTSW 12 29984927 missense probably damaging 1.00
R7572:Pxdn UTSW 12 30006705 missense probably damaging 1.00
R7708:Pxdn UTSW 12 30006602 missense probably damaging 0.99
R7815:Pxdn UTSW 12 30005825 missense probably damaging 0.96
R7972:Pxdn UTSW 12 30006602 missense probably damaging 0.99
R8097:Pxdn UTSW 12 30006602 missense probably damaging 0.99
R8098:Pxdn UTSW 12 30006602 missense probably damaging 0.99
R8205:Pxdn UTSW 12 30006567 missense probably damaging 1.00
R8262:Pxdn UTSW 12 29999196 nonsense probably null
R8335:Pxdn UTSW 12 30002097 missense probably damaging 0.99
R8356:Pxdn UTSW 12 30011890 missense probably damaging 0.99
R8437:Pxdn UTSW 12 30002044 missense probably damaging 1.00
R8456:Pxdn UTSW 12 30011890 missense probably damaging 0.99
R8709:Pxdn UTSW 12 30006602 missense probably damaging 0.99
R8772:Pxdn UTSW 12 30015464 missense probably damaging 1.00
Z1177:Pxdn UTSW 12 29990852 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACGCTCCAATTAGTGTCTTCAG -3'
(R):5'- TGTCTGAGATCCCAACTTGTCC -3'

Sequencing Primer
(F):5'- TCCAGCTGAGTCGAGCACAG -3'
(R):5'- GAGATCCCAACTTGTCCTGTGG -3'
Posted On2018-11-06