Mutagenetix > Incidental Mutation

Incidental Mutation 'R6921:Nipbl'

539658

Institutional Source

Beutler Lab

Gene Symbol

Nipbl

Ensembl Gene

ENSMUSG00000022141

Gene Name

NIPBL cohesin loading factor

Synonyms

4921518A06Rik, 4933421G18Rik

MMRRC Submission

045006-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.962) question?

Stock #

R6921 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

8290617-8444463 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 8303485 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 2218 (N2218S)

Ref Sequence

ENSEMBL: ENSMUSP00000059385 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000052965]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000052965
AA Change: N2218S

PolyPhen 2 Score 0.279 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000059385
Gene: ENSMUSG00000022141
AA Change: N2218S

Domain	Start	End	E-Value	Type
low complexity region	22	41	N/A	INTRINSIC
low complexity region	322	338	N/A	INTRINSIC
low complexity region	367	376	N/A	INTRINSIC
low complexity region	447	462	N/A	INTRINSIC
low complexity region	473	490	N/A	INTRINSIC
low complexity region	639	652	N/A	INTRINSIC
low complexity region	1020	1037	N/A	INTRINSIC
low complexity region	1081	1097	N/A	INTRINSIC
low complexity region	1102	1107	N/A	INTRINSIC
low complexity region	1114	1139	N/A	INTRINSIC
low complexity region	1165	1176	N/A	INTRINSIC
low complexity region	1389	1396	N/A	INTRINSIC
low complexity region	1577	1586	N/A	INTRINSIC
coiled coil region	1628	1656	N/A	INTRINSIC
Pfam:Cohesin_HEAT	1788	1829	1.1e-14	PFAM
Pfam:Nipped-B_C	2269	2450	2.8e-68	PFAM
low complexity region	2477	2501	N/A	INTRINSIC
low complexity region	2502	2512	N/A	INTRINSIC
low complexity region	2538	2550	N/A	INTRINSIC
low complexity region	2626	2632	N/A	INTRINSIC
low complexity region	2660	2684	N/A	INTRINSIC

Meta Mutation Damage Score

0.0706

Coding Region Coverage

1x: 100.0%
3x: 99.8%
10x: 98.9%
20x: 96.4%

Validation Efficiency

96% (46/48)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the homolog of the Drosophila melanogaster Nipped-B gene product and fungal Scc2-type sister chromatid cohesion proteins. The Drosophila protein facilitates enhancer-promoter communication of remote enhancers and plays a role in developmental regulation. It is also homologous to a family of chromosomal adherins with broad roles in sister chromatid cohesion, chromosome condensation, and DNA repair. The human protein has a bipartite nuclear targeting sequence and a putative HEAT repeat. Condensins, cohesins and other complexes with chromosome-related functions also contain HEAT repeats. Mutations in this gene result in Cornelia de Lange syndrome, a disorder characterized by dysmorphic facial features, growth delay, limb reduction defects, and mental retardation. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Nullizygous mice are embryonic lethal. Heterozygous null mice are growth-retarded and show various skeletal anomalies. Heterozygotes for a gene-trap allele are small and show craniofacial, heart, eye, hearing and behavioral defects, delayed bone maturation, reduced body fat, and postnatal mortality. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 47 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700017B05Rik	A	T	9: 57,258,736 (GRCm38)	H118Q	probably damaging	Het
Adgrl3	T	G	5: 81,648,713 (GRCm38)	V623G	probably damaging	Het
B9d2	A	G	7: 25,686,017 (GRCm38)	D84G	probably damaging	Het
Clec1a	A	T	6: 129,428,864 (GRCm38)	L268H	probably damaging	Het
Copa	A	T	1: 172,111,924 (GRCm38)	N576I	possibly damaging	Het
Cyp11b1	T	C	15: 74,840,949 (GRCm38)	T88A	probably benign	Het
Dis3l2	T	C	1: 86,857,341 (GRCm38)	I318T	probably benign	Het
Dmtf1	T	C	5: 9,130,654 (GRCm38)		probably benign	Het
Dnah17	C	A	11: 118,041,484 (GRCm38)	A3639S	probably damaging	Het
Dnajc8	T	A	4: 132,544,720 (GRCm38)	I89N	probably damaging	Het
Dync2h1	T	A	9: 7,102,549 (GRCm38)	H377L	probably benign	Het
Elmsan1	A	G	12: 84,156,459 (GRCm38)	S890P	probably damaging	Het
Erfe	T	A	1: 91,370,332 (GRCm38)	I212N	probably benign	Het
Fam117b	A	G	1: 59,952,935 (GRCm38)	T248A	probably damaging	Het
Fbxo10	A	T	4: 45,044,849 (GRCm38)	N595K	probably damaging	Het
Fzd10	T	A	5: 128,601,582 (GRCm38)	M122K	probably damaging	Het
Gm4070	G	A	7: 105,901,980 (GRCm38)	Q622*	probably null	Het
Gpr15	C	T	16: 58,717,781 (GRCm38)	R315H	probably benign	Het
H6pd	T	C	4: 149,982,051 (GRCm38)	D626G	probably damaging	Het
Hexdc	A	G	11: 121,222,281 (GRCm38)	D514G	probably damaging	Het
Hoxd4	T	C	2: 74,728,492 (GRCm38)	S220P	possibly damaging	Het
Invs	A	G	4: 48,396,260 (GRCm38)	H311R	possibly damaging	Het
Ip6k1	A	G	9: 108,024,435 (GRCm38)	T70A	probably damaging	Het
Lipt2	T	C	7: 100,160,371 (GRCm38)	C222R	probably damaging	Het
Lrrc3	T	A	10: 77,901,032 (GRCm38)	D190V	probably damaging	Het
March10	T	C	11: 105,389,777 (GRCm38)	T561A	probably benign	Het
Mcm10	G	A	2: 5,000,935 (GRCm38)	T463I	probably benign	Het
Mmel1	T	C	4: 154,881,677 (GRCm38)	L52P	probably damaging	Het
Nr4a3	C	T	4: 48,051,486 (GRCm38)	P80L	probably benign	Het
Nrip1	C	T	16: 76,292,588 (GRCm38)	G694R	possibly damaging	Het
Oit3	A	T	10: 59,435,945 (GRCm38)	C197S	probably damaging	Het
Olfr1042	C	T	2: 86,159,852 (GRCm38)	V173M	probably benign	Het
Olfr904	A	G	9: 38,464,247 (GRCm38)	I69V	probably benign	Het
Otol1	A	G	3: 70,028,100 (GRCm38)	E475G	possibly damaging	Het
Pes1	T	C	11: 3,973,330 (GRCm38)	F168L	probably damaging	Het
Plch1	C	T	3: 63,707,734 (GRCm38)	R780H	possibly damaging	Het
Pxdn	C	G	12: 30,015,505 (GRCm38)	P1275A	probably damaging	Het
Sgcz	T	C	8: 37,526,289 (GRCm38)	E218G	probably damaging	Het
Slc27a5	A	T	7: 12,991,208 (GRCm38)	N437K	probably damaging	Het
Sult2b1	A	G	7: 45,735,188 (GRCm38)	S155P	probably damaging	Het
Tgfbrap1	T	C	1: 43,051,896 (GRCm38)	M690V	probably benign	Het
Tmem151a	A	T	19: 5,083,091 (GRCm38)	L29Q	probably damaging	Het
Tmprss2	A	G	16: 97,568,437 (GRCm38)	I379T	probably damaging	Het
Vmn1r168	T	A	7: 23,540,898 (GRCm38)	V60E	probably damaging	Het
Vmn2r73	A	C	7: 85,858,238 (GRCm38)	V622G	probably benign	Het
Wdr72	A	G	9: 74,210,646 (GRCm38)	H880R	probably benign	Het
Zfhx3	A	G	8: 108,951,392 (GRCm38)	T3025A	possibly damaging	Het

Other mutations in Nipbl

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00417:Nipbl	APN	15	8,366,673 (GRCm38)	missense	probably damaging	0.98
IGL00712:Nipbl	APN	15	8,369,474 (GRCm38)	missense	probably damaging	0.97
IGL00789:Nipbl	APN	15	8,296,869 (GRCm38)	missense	probably damaging	1.00
IGL01025:Nipbl	APN	15	8,350,455 (GRCm38)	missense	possibly damaging	0.46
IGL01087:Nipbl	APN	15	8,350,497 (GRCm38)	missense	possibly damaging	0.67
IGL01474:Nipbl	APN	15	8,311,209 (GRCm38)	missense	possibly damaging	0.63
IGL01537:Nipbl	APN	15	8,350,539 (GRCm38)	missense	probably benign
IGL01723:Nipbl	APN	15	8,335,071 (GRCm38)	missense	possibly damaging	0.71
IGL01749:Nipbl	APN	15	8,361,821 (GRCm38)	missense	probably benign	0.13
IGL02398:Nipbl	APN	15	8,327,090 (GRCm38)	missense	probably damaging	1.00
IGL02437:Nipbl	APN	15	8,359,074 (GRCm38)	missense	probably damaging	1.00
IGL02450:Nipbl	APN	15	8,343,574 (GRCm38)	missense	probably damaging	0.99
IGL02477:Nipbl	APN	15	8,323,647 (GRCm38)	splice site	probably null
IGL02547:Nipbl	APN	15	8,351,598 (GRCm38)	missense	probably benign
IGL02678:Nipbl	APN	15	8,351,110 (GRCm38)	missense	possibly damaging	0.92
IGL02679:Nipbl	APN	15	8,295,553 (GRCm38)	missense	probably benign	0.34
IGL03003:Nipbl	APN	15	8,350,314 (GRCm38)	missense	probably damaging	1.00
IGL03117:Nipbl	APN	15	8,332,452 (GRCm38)	missense	probably damaging	1.00
IGL03162:Nipbl	APN	15	8,338,979 (GRCm38)	missense	probably benign	0.37
IGL03224:Nipbl	APN	15	8,293,085 (GRCm38)	missense	probably damaging	0.98
IGL03339:Nipbl	APN	15	8,350,876 (GRCm38)	missense	probably benign	0.12
R0346_Nipbl_297	UTSW	15	8,360,956 (GRCm38)	missense	probably damaging	0.99
R0347_Nipbl_476	UTSW	15	8,350,732 (GRCm38)	missense	probably benign
R3620_nipbl_616	UTSW	15	8,333,024 (GRCm38)	missense	probably damaging	0.99
R6388_Nipbl_651	UTSW	15	8,300,784 (GRCm38)	missense	probably damaging	0.99
R8441_Nipbl_224	UTSW	15	8,293,115 (GRCm38)	missense	probably benign	0.00
R0271:Nipbl	UTSW	15	8,361,737 (GRCm38)	missense	possibly damaging	0.76
R0346:Nipbl	UTSW	15	8,360,956 (GRCm38)	missense	probably damaging	0.99
R0347:Nipbl	UTSW	15	8,350,732 (GRCm38)	missense	probably benign
R0422:Nipbl	UTSW	15	8,351,628 (GRCm38)	missense	probably benign
R0486:Nipbl	UTSW	15	8,338,870 (GRCm38)	splice site	probably benign
R0652:Nipbl	UTSW	15	8,303,480 (GRCm38)	missense	probably benign	0.23
R0667:Nipbl	UTSW	15	8,361,004 (GRCm38)	missense	possibly damaging	0.86
R0689:Nipbl	UTSW	15	8,293,078 (GRCm38)	splice site	probably null
R0726:Nipbl	UTSW	15	8,351,555 (GRCm38)	missense	probably benign
R0881:Nipbl	UTSW	15	8,307,612 (GRCm38)	missense	probably damaging	0.98
R0904:Nipbl	UTSW	15	8,361,718 (GRCm38)	missense	probably benign
R0969:Nipbl	UTSW	15	8,292,228 (GRCm38)	missense	probably damaging	1.00
R1401:Nipbl	UTSW	15	8,372,173 (GRCm38)	missense	probably damaging	0.97
R1479:Nipbl	UTSW	15	8,350,289 (GRCm38)	missense	probably benign	0.00
R1495:Nipbl	UTSW	15	8,351,280 (GRCm38)	missense	probably benign	0.00
R1609:Nipbl	UTSW	15	8,366,664 (GRCm38)	missense	probably damaging	1.00
R1679:Nipbl	UTSW	15	8,302,912 (GRCm38)	missense	probably benign	0.31
R1756:Nipbl	UTSW	15	8,338,551 (GRCm38)	missense	possibly damaging	0.91
R1778:Nipbl	UTSW	15	8,319,488 (GRCm38)	missense	probably damaging	1.00
R1835:Nipbl	UTSW	15	8,343,517 (GRCm38)	missense	possibly damaging	0.80
R1883:Nipbl	UTSW	15	8,327,132 (GRCm38)	missense	probably damaging	1.00
R1914:Nipbl	UTSW	15	8,343,630 (GRCm38)	missense	possibly damaging	0.93
R1915:Nipbl	UTSW	15	8,343,630 (GRCm38)	missense	possibly damaging	0.93
R2030:Nipbl	UTSW	15	8,350,287 (GRCm38)	missense	probably damaging	1.00
R2046:Nipbl	UTSW	15	8,324,467 (GRCm38)	missense	probably benign	0.08
R2076:Nipbl	UTSW	15	8,311,207 (GRCm38)	missense	probably benign	0.11
R2163:Nipbl	UTSW	15	8,336,919 (GRCm38)	missense	probably damaging	0.99
R2170:Nipbl	UTSW	15	8,293,218 (GRCm38)	missense	probably damaging	1.00
R2425:Nipbl	UTSW	15	8,351,482 (GRCm38)	missense	probably benign	0.06
R2475:Nipbl	UTSW	15	8,335,006 (GRCm38)	missense	probably benign	0.05
R2484:Nipbl	UTSW	15	8,323,698 (GRCm38)	missense	probably damaging	0.99
R2970:Nipbl	UTSW	15	8,311,239 (GRCm38)	missense	probably damaging	1.00
R3116:Nipbl	UTSW	15	8,343,592 (GRCm38)	missense	probably benign	0.00
R3620:Nipbl	UTSW	15	8,333,024 (GRCm38)	missense	probably damaging	0.99
R3725:Nipbl	UTSW	15	8,295,661 (GRCm38)	missense	probably damaging	0.97
R3745:Nipbl	UTSW	15	8,358,874 (GRCm38)	missense	probably benign
R3902:Nipbl	UTSW	15	8,350,246 (GRCm38)	missense	possibly damaging	0.94
R3960:Nipbl	UTSW	15	8,350,534 (GRCm38)	missense	probably benign
R4164:Nipbl	UTSW	15	8,338,934 (GRCm38)	missense	probably benign	0.24
R4246:Nipbl	UTSW	15	8,332,432 (GRCm38)	missense	probably damaging	1.00
R4381:Nipbl	UTSW	15	8,359,206 (GRCm38)	missense	probably benign	0.00
R4394:Nipbl	UTSW	15	8,361,861 (GRCm38)	missense	probably benign	0.00
R4439:Nipbl	UTSW	15	8,338,724 (GRCm38)	missense	probably damaging	0.98
R4440:Nipbl	UTSW	15	8,366,658 (GRCm38)	missense	probably damaging	0.98
R4441:Nipbl	UTSW	15	8,366,658 (GRCm38)	missense	probably damaging	0.98
R4672:Nipbl	UTSW	15	8,302,984 (GRCm38)	missense	probably damaging	1.00
R4749:Nipbl	UTSW	15	8,365,829 (GRCm38)	missense	possibly damaging	0.95
R5300:Nipbl	UTSW	15	8,351,497 (GRCm38)	missense	probably benign
R5428:Nipbl	UTSW	15	8,330,296 (GRCm38)	missense	probably benign	0.00
R5641:Nipbl	UTSW	15	8,366,712 (GRCm38)	missense	possibly damaging	0.93
R5643:Nipbl	UTSW	15	8,358,907 (GRCm38)	missense	probably benign
R5644:Nipbl	UTSW	15	8,358,907 (GRCm38)	missense	probably benign
R5681:Nipbl	UTSW	15	8,301,382 (GRCm38)	missense	probably benign	0.22
R5741:Nipbl	UTSW	15	8,324,649 (GRCm38)	missense	possibly damaging	0.47
R5899:Nipbl	UTSW	15	8,334,844 (GRCm38)	splice site	probably null
R5970:Nipbl	UTSW	15	8,296,818 (GRCm38)	missense	probably benign	0.27
R6041:Nipbl	UTSW	15	8,324,264 (GRCm38)	missense	probably damaging	1.00
R6059:Nipbl	UTSW	15	8,295,568 (GRCm38)	missense	probably damaging	1.00
R6213:Nipbl	UTSW	15	8,334,906 (GRCm38)	missense	probably damaging	1.00
R6216:Nipbl	UTSW	15	8,318,383 (GRCm38)	missense	probably damaging	0.99
R6236:Nipbl	UTSW	15	8,324,580 (GRCm38)	missense	possibly damaging	0.88
R6267:Nipbl	UTSW	15	8,300,895 (GRCm38)	missense	possibly damaging	0.46
R6296:Nipbl	UTSW	15	8,300,895 (GRCm38)	missense	possibly damaging	0.46
R6388:Nipbl	UTSW	15	8,300,784 (GRCm38)	missense	probably damaging	0.99
R6427:Nipbl	UTSW	15	8,351,565 (GRCm38)	missense	probably benign
R6707:Nipbl	UTSW	15	8,324,559 (GRCm38)	missense	probably benign	0.01
R6731:Nipbl	UTSW	15	8,322,590 (GRCm38)	missense	probably damaging	1.00
R7239:Nipbl	UTSW	15	8,292,135 (GRCm38)	critical splice donor site	probably null
R7346:Nipbl	UTSW	15	8,343,606 (GRCm38)	missense	possibly damaging	0.94
R7485:Nipbl	UTSW	15	8,330,295 (GRCm38)	missense	probably benign	0.01
R7486:Nipbl	UTSW	15	8,295,636 (GRCm38)	missense	probably benign	0.25
R7598:Nipbl	UTSW	15	8,343,493 (GRCm38)	missense	probably benign	0.24
R7609:Nipbl	UTSW	15	8,305,872 (GRCm38)	missense	probably benign	0.27
R7674:Nipbl	UTSW	15	8,293,101 (GRCm38)	missense	probably benign	0.15
R7706:Nipbl	UTSW	15	8,351,526 (GRCm38)	missense	probably benign	0.01
R7760:Nipbl	UTSW	15	8,358,702 (GRCm38)	missense	probably damaging	1.00
R7766:Nipbl	UTSW	15	8,296,849 (GRCm38)	missense	probably benign	0.45
R7825:Nipbl	UTSW	15	8,291,487 (GRCm38)	missense	probably damaging	1.00
R7862:Nipbl	UTSW	15	8,325,752 (GRCm38)	missense	probably benign	0.06
R7958:Nipbl	UTSW	15	8,311,258 (GRCm38)	missense	possibly damaging	0.91
R8077:Nipbl	UTSW	15	8,311,250 (GRCm38)	missense	possibly damaging	0.49
R8119:Nipbl	UTSW	15	8,359,212 (GRCm38)	missense	probably benign	0.22
R8355:Nipbl	UTSW	15	8,335,044 (GRCm38)	missense	probably damaging	0.98
R8441:Nipbl	UTSW	15	8,293,115 (GRCm38)	missense	probably benign	0.00
R8455:Nipbl	UTSW	15	8,335,044 (GRCm38)	missense	probably damaging	0.98
R8717:Nipbl	UTSW	15	8,338,741 (GRCm38)	missense	probably benign
R8739:Nipbl	UTSW	15	8,303,420 (GRCm38)	missense	probably benign	0.08
R8854:Nipbl	UTSW	15	8,300,726 (GRCm38)	missense	probably damaging	1.00
R8887:Nipbl	UTSW	15	8,361,787 (GRCm38)	missense	probably damaging	1.00
R8942:Nipbl	UTSW	15	8,351,620 (GRCm38)	missense	probably benign
R8991:Nipbl	UTSW	15	8,291,513 (GRCm38)	missense	probably damaging	1.00
R9008:Nipbl	UTSW	15	8,327,124 (GRCm38)	missense	probably damaging	1.00
R9070:Nipbl	UTSW	15	8,338,731 (GRCm38)	missense	possibly damaging	0.82
R9116:Nipbl	UTSW	15	8,350,856 (GRCm38)	missense	probably benign	0.00
R9622:Nipbl	UTSW	15	8,336,889 (GRCm38)	missense	probably benign	0.27
R9778:Nipbl	UTSW	15	8,291,548 (GRCm38)	missense	probably benign	0.10
RF020:Nipbl	UTSW	15	8,358,934 (GRCm38)	missense	probably damaging	0.98
X0022:Nipbl	UTSW	15	8,351,715 (GRCm38)	missense	probably benign	0.05
X0027:Nipbl	UTSW	15	8,323,537 (GRCm38)	missense	probably damaging	1.00
Z1088:Nipbl	UTSW	15	8,307,882 (GRCm38)	missense	probably damaging	1.00
Z1176:Nipbl	UTSW	15	8,338,699 (GRCm38)	missense	possibly damaging	0.88
Z1177:Nipbl	UTSW	15	8,338,680 (GRCm38)	critical splice donor site	probably null
Z1177:Nipbl	UTSW	15	8,336,952 (GRCm38)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACGAGGAATGTTTCTGCTCTG -3'
(R):5'- TTGCTTCTCTAGGTAAGGCCAC -3'

Sequencing Primer
(F):5'- TCTGCTCTGGAGTCGAGAAGAG -3'
(R):5'- TAGGTAAGGCCACCCGCATATTC -3'

Posted On

2018-11-06