Incidental Mutation 'R6921:Tmem151a'
ID539663
Institutional Source Beutler Lab
Gene Symbol Tmem151a
Ensembl Gene ENSMUSG00000061451
Gene Nametransmembrane protein 151A
SynonymsLOC381199, Tmem151
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock #R6921 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location5070859-5085531 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 5083091 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 29 (L29Q)
Ref Sequence ENSEMBL: ENSMUSP00000076321 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077066] [ENSMUST00000140389] [ENSMUST00000151413]
Predicted Effect probably damaging
Transcript: ENSMUST00000077066
AA Change: L29Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000076321
Gene: ENSMUSG00000061451
AA Change: L29Q

DomainStartEndE-ValueType
Pfam:TMEM151 26 373 8.6e-179 PFAM
low complexity region 420 431 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000140389
Predicted Effect probably benign
Transcript: ENSMUST00000151413
SMART Domains Protein: ENSMUSP00000121084
Gene: ENSMUSG00000061451

DomainStartEndE-ValueType
low complexity region 37 48 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.8%
  • 10x: 98.9%
  • 20x: 96.4%
Validation Efficiency 96% (46/48)
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017B05Rik A T 9: 57,258,736 H118Q probably damaging Het
Adgrl3 T G 5: 81,648,713 V623G probably damaging Het
B9d2 A G 7: 25,686,017 D84G probably damaging Het
Clec1a A T 6: 129,428,864 L268H probably damaging Het
Copa A T 1: 172,111,924 N576I possibly damaging Het
Cyp11b1 T C 15: 74,840,949 T88A probably benign Het
Dis3l2 T C 1: 86,857,341 I318T probably benign Het
Dmtf1 T C 5: 9,130,654 probably benign Het
Dnah17 C A 11: 118,041,484 A3639S probably damaging Het
Dnajc8 T A 4: 132,544,720 I89N probably damaging Het
Dync2h1 T A 9: 7,102,549 H377L probably benign Het
Elmsan1 A G 12: 84,156,459 S890P probably damaging Het
Erfe T A 1: 91,370,332 I212N probably benign Het
Fam117b A G 1: 59,952,935 T248A probably damaging Het
Fbxo10 A T 4: 45,044,849 N595K probably damaging Het
Fzd10 T A 5: 128,601,582 M122K probably damaging Het
Gm4070 G A 7: 105,901,980 Q622* probably null Het
Gpr15 C T 16: 58,717,781 R315H probably benign Het
H6pd T C 4: 149,982,051 D626G probably damaging Het
Hexdc A G 11: 121,222,281 D514G probably damaging Het
Hoxd4 T C 2: 74,728,492 S220P possibly damaging Het
Invs A G 4: 48,396,260 H311R possibly damaging Het
Ip6k1 A G 9: 108,024,435 T70A probably damaging Het
Lipt2 T C 7: 100,160,371 C222R probably damaging Het
Lrrc3 T A 10: 77,901,032 D190V probably damaging Het
March10 T C 11: 105,389,777 T561A probably benign Het
Mcm10 G A 2: 5,000,935 T463I probably benign Het
Mmel1 T C 4: 154,881,677 L52P probably damaging Het
Nipbl T C 15: 8,303,485 N2218S probably benign Het
Nr4a3 C T 4: 48,051,486 P80L probably benign Het
Nrip1 C T 16: 76,292,588 G694R possibly damaging Het
Oit3 A T 10: 59,435,945 C197S probably damaging Het
Olfr1042 C T 2: 86,159,852 V173M probably benign Het
Olfr904 A G 9: 38,464,247 I69V probably benign Het
Otol1 A G 3: 70,028,100 E475G possibly damaging Het
Pes1 T C 11: 3,973,330 F168L probably damaging Het
Plch1 C T 3: 63,707,734 R780H possibly damaging Het
Pxdn C G 12: 30,015,505 P1275A probably damaging Het
Sgcz T C 8: 37,526,289 E218G probably damaging Het
Slc27a5 A T 7: 12,991,208 N437K probably damaging Het
Sult2b1 A G 7: 45,735,188 S155P probably damaging Het
Tgfbrap1 T C 1: 43,051,896 M690V probably benign Het
Tmprss2 A G 16: 97,568,437 I379T probably damaging Het
Vmn1r168 T A 7: 23,540,898 V60E probably damaging Het
Vmn2r73 A C 7: 85,858,238 V622G probably benign Het
Wdr72 A G 9: 74,210,646 H880R probably benign Het
Zfhx3 A G 8: 108,951,392 T3025A possibly damaging Het
Other mutations in Tmem151a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01913:Tmem151a APN 19 5081892 missense probably benign 0.36
IGL02708:Tmem151a APN 19 5082847 nonsense probably null
IGL02887:Tmem151a APN 19 5082965 missense probably benign
IGL03144:Tmem151a APN 19 5085372 start codon destroyed probably benign 0.01
R0395:Tmem151a UTSW 19 5082233 missense probably damaging 1.00
R1732:Tmem151a UTSW 19 5082867 missense probably damaging 1.00
R2011:Tmem151a UTSW 19 5082938 missense probably benign
R4399:Tmem151a UTSW 19 5083071 missense probably damaging 1.00
R4612:Tmem151a UTSW 19 5071834 unclassified probably benign
R5171:Tmem151a UTSW 19 5082033 missense probably damaging 1.00
R7205:Tmem151a UTSW 19 5082773 missense probably damaging 1.00
R7413:Tmem151a UTSW 19 5082674 missense probably damaging 1.00
R7544:Tmem151a UTSW 19 5071867 missense unknown
X0010:Tmem151a UTSW 19 5082986 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTACAGGTAGCCATCCGAG -3'
(R):5'- TAGCCAAATGCACACAGAGG -3'

Sequencing Primer
(F):5'- TAGCCATCCGAGCAGGGAC -3'
(R):5'- GCAACTGCCAGAAATCAGATTTC -3'
Posted On2018-11-06