Incidental Mutation 'R6922:Gm29106'
ID539665
Institutional Source Beutler Lab
Gene Symbol Gm29106
Ensembl Gene ENSMUSG00000102030
Gene Namepredicted gene 29106
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.369) question?
Stock #R6922 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location118176542-118202307 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 118199794 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Serine at position 405 (R405S)
Ref Sequence ENSEMBL: ENSMUSP00000141137 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000186264]
Predicted Effect probably damaging
Transcript: ENSMUST00000186264
AA Change: R405S

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000141137
Gene: ENSMUSG00000102030
AA Change: R405S

DomainStartEndE-ValueType
KRAB 8 66 2.8e-24 SMART
ZnF_C2H2 77 97 2.3e-2 SMART
ZnF_C2H2 105 127 4.5e-6 SMART
ZnF_C2H2 133 155 3.4e-6 SMART
ZnF_C2H2 161 183 3.2e-7 SMART
ZnF_C2H2 189 211 2.1e-4 SMART
ZnF_C2H2 217 239 6.3e-7 SMART
ZnF_C2H2 245 267 3.4e-6 SMART
ZnF_C2H2 273 295 3.2e-7 SMART
ZnF_C2H2 301 323 2.1e-4 SMART
ZnF_C2H2 329 351 6.3e-7 SMART
ZnF_C2H2 357 379 2.1e-4 SMART
ZnF_C2H2 385 407 7.8e-5 SMART
ZnF_C2H2 413 435 1.1e-7 SMART
ZnF_C2H2 441 463 4e-5 SMART
ZnF_C2H2 469 491 1.3e-6 SMART
ZnF_C2H2 497 519 2.4e-6 SMART
ZnF_C2H2 525 547 2.3e-4 SMART
ZnF_C2H2 553 575 1.4e-4 SMART
ZnF_C2H2 581 603 1.9e-6 SMART
ZnF_C2H2 609 631 5.2e-5 SMART
ZnF_C2H2 637 659 1.7e-5 SMART
ZnF_C2H2 665 687 9.4e-7 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810013L24Rik A G 16: 8,830,689 probably null Het
Ago2 T C 15: 73,113,752 I665V probably benign Het
Arhgap32 A T 9: 32,152,687 M74L possibly damaging Het
Asb4 T C 6: 5,398,304 C90R possibly damaging Het
B3galt4 T A 17: 33,950,847 D139V probably damaging Het
Camta2 A C 11: 70,674,138 I852S probably benign Het
Cox4i2 G T 2: 152,757,095 E57D probably benign Het
Dip2b T C 15: 100,193,843 I1055T probably benign Het
Eif4g3 C T 4: 138,097,335 P284S probably damaging Het
Ephb1 C A 9: 101,929,264 probably null Het
Fbxw7 A T 3: 84,972,416 probably null Het
Frem1 C A 4: 82,922,269 D1789Y probably damaging Het
Gm16368 T A 12: 88,083,832 W46R probably benign Het
Gm609 A T 16: 45,443,931 M88K probably benign Het
Greb1l G A 18: 10,547,482 V1567M possibly damaging Het
Heatr1 C A 13: 12,435,075 D1983E probably benign Het
Lhfpl2 G T 13: 94,174,521 A100S probably damaging Het
Lrp5 A T 19: 3,605,301 V1073D probably damaging Het
Naip6 G A 13: 100,302,198 L364F possibly damaging Het
Nek9 A G 12: 85,303,537 L921P probably damaging Het
Nim1k C T 13: 119,727,727 E49K probably damaging Het
Nsun5 A C 5: 135,370,192 N32T probably damaging Het
Nuggc T C 14: 65,617,643 S325P probably damaging Het
Olfr1135 T A 2: 87,671,453 K305* probably null Het
Olfr716 A G 7: 107,148,083 I256V probably damaging Het
Pcdhga7 A G 18: 37,715,657 D239G probably damaging Het
Pld2 A G 11: 70,553,447 D523G probably benign Het
Prokr1 C A 6: 87,588,473 W130L probably damaging Het
Prpf8 A G 11: 75,490,736 N266S probably damaging Het
Rdh10 T C 1: 16,106,031 V5A probably benign Het
Rp1l1 T C 14: 64,030,385 L1140P possibly damaging Het
Sacs A G 14: 61,211,425 D3640G probably damaging Het
Smarca2 A G 19: 26,691,349 E916G probably damaging Het
Steap3 A T 1: 120,243,894 H160Q probably damaging Het
Svs1 T G 6: 48,987,574 F172C probably damaging Het
Tlk2 T C 11: 105,256,953 probably null Het
Tmprss4 A G 9: 45,185,922 V15A probably benign Het
Togaram2 T C 17: 71,707,134 L559P probably damaging Het
Topbp1 T A 9: 103,335,846 L990H probably damaging Het
Ttll7 A G 3: 146,909,614 T278A possibly damaging Het
Ttn G A 2: 76,774,436 L18385F probably damaging Het
Upf3a G T 8: 13,791,911 A149S probably damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Zfp316 A T 5: 143,253,525 F913Y probably damaging Het
Other mutations in Gm29106
AlleleSourceChrCoordTypePredicted EffectPPH Score
R4985:Gm29106 UTSW 1 118199220 missense probably benign 0.02
R4991:Gm29106 UTSW 1 118178391 missense probably benign 0.01
R6029:Gm29106 UTSW 1 118200260 missense probably damaging 1.00
R6954:Gm29106 UTSW 1 118200587 missense probably damaging 1.00
R6961:Gm29106 UTSW 1 118200398 nonsense probably null
R7232:Gm29106 UTSW 1 118199561 missense probably damaging 1.00
R7337:Gm29106 UTSW 1 118176912 missense unknown
R7457:Gm29106 UTSW 1 118199252 missense probably damaging 1.00
R7662:Gm29106 UTSW 1 118199407 missense possibly damaging 0.89
R7870:Gm29106 UTSW 1 118199155 missense possibly damaging 0.55
R7894:Gm29106 UTSW 1 118199535 missense probably damaging 1.00
R7953:Gm29106 UTSW 1 118199155 missense possibly damaging 0.55
R7977:Gm29106 UTSW 1 118199535 missense probably damaging 1.00
R8099:Gm29106 UTSW 1 118198791 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AAATTCACCAGAGAATCCATACAGG -3'
(R):5'- TCTGGTGAACTTTAAGACTTGATAAC -3'

Sequencing Primer
(F):5'- TACAGGAGACAAGCCTTACAAATG -3'
(R):5'- CCCCAGTATGGATTCTATGGTGAAC -3'
Posted On2018-11-06