Incidental Mutation 'R6922:Olfr716'
ID539679
Institutional Source Beutler Lab
Gene Symbol Olfr716
Ensembl Gene ENSMUSG00000073896
Gene Nameolfactory receptor 716
SynonymsGA_x6K02T2PBJ9-9497411-9498355, MOR260-2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock #R6922 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location107138327-107150581 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 107148083 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 256 (I256V)
Ref Sequence ENSEMBL: ENSMUSP00000150175 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098137] [ENSMUST00000209942] [ENSMUST00000210474] [ENSMUST00000213367] [ENSMUST00000214819] [ENSMUST00000215284] [ENSMUST00000216871]
Predicted Effect probably damaging
Transcript: ENSMUST00000098137
AA Change: I256V

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000095740
Gene: ENSMUSG00000073896
AA Change: I256V

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 2.4e-57 PFAM
Pfam:7tm_1 41 290 3.9e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000209942
Predicted Effect probably benign
Transcript: ENSMUST00000210474
Predicted Effect probably damaging
Transcript: ENSMUST00000213367
AA Change: I256V

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000214819
AA Change: I256V

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000215284
AA Change: I256V

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000216871
AA Change: I256V

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.7%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810013L24Rik A G 16: 8,830,689 probably null Het
Ago2 T C 15: 73,113,752 I665V probably benign Het
Arhgap32 A T 9: 32,152,687 M74L possibly damaging Het
Asb4 T C 6: 5,398,304 C90R possibly damaging Het
B3galt4 T A 17: 33,950,847 D139V probably damaging Het
Camta2 A C 11: 70,674,138 I852S probably benign Het
Cox4i2 G T 2: 152,757,095 E57D probably benign Het
Dip2b T C 15: 100,193,843 I1055T probably benign Het
Eif4g3 C T 4: 138,097,335 P284S probably damaging Het
Ephb1 C A 9: 101,929,264 probably null Het
Fbxw7 A T 3: 84,972,416 probably null Het
Frem1 C A 4: 82,922,269 D1789Y probably damaging Het
Gm16368 T A 12: 88,083,832 W46R probably benign Het
Gm29106 A T 1: 118,199,794 R405S probably damaging Het
Gm609 A T 16: 45,443,931 M88K probably benign Het
Greb1l G A 18: 10,547,482 V1567M possibly damaging Het
Heatr1 C A 13: 12,435,075 D1983E probably benign Het
Lhfpl2 G T 13: 94,174,521 A100S probably damaging Het
Lrp5 A T 19: 3,605,301 V1073D probably damaging Het
Naip6 G A 13: 100,302,198 L364F possibly damaging Het
Nek9 A G 12: 85,303,537 L921P probably damaging Het
Nim1k C T 13: 119,727,727 E49K probably damaging Het
Nsun5 A C 5: 135,370,192 N32T probably damaging Het
Nuggc T C 14: 65,617,643 S325P probably damaging Het
Olfr1135 T A 2: 87,671,453 K305* probably null Het
Pcdhga7 A G 18: 37,715,657 D239G probably damaging Het
Pld2 A G 11: 70,553,447 D523G probably benign Het
Prokr1 C A 6: 87,588,473 W130L probably damaging Het
Prpf8 A G 11: 75,490,736 N266S probably damaging Het
Rdh10 T C 1: 16,106,031 V5A probably benign Het
Rp1l1 T C 14: 64,030,385 L1140P possibly damaging Het
Sacs A G 14: 61,211,425 D3640G probably damaging Het
Smarca2 A G 19: 26,691,349 E916G probably damaging Het
Steap3 A T 1: 120,243,894 H160Q probably damaging Het
Svs1 T G 6: 48,987,574 F172C probably damaging Het
Tlk2 T C 11: 105,256,953 probably null Het
Tmprss4 A G 9: 45,185,922 V15A probably benign Het
Togaram2 T C 17: 71,707,134 L559P probably damaging Het
Topbp1 T A 9: 103,335,846 L990H probably damaging Het
Ttll7 A G 3: 146,909,614 T278A possibly damaging Het
Ttn G A 2: 76,774,436 L18385F probably damaging Het
Upf3a G T 8: 13,791,911 A149S probably damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Zfp316 A T 5: 143,253,525 F913Y probably damaging Het
Other mutations in Olfr716
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01781:Olfr716 APN 7 107147696 missense probably damaging 1.00
IGL02792:Olfr716 APN 7 107148218 missense probably benign 0.00
IGL03300:Olfr716 APN 7 107147409 missense probably damaging 1.00
R0071:Olfr716 UTSW 7 107147712 missense probably damaging 1.00
R0071:Olfr716 UTSW 7 107147712 missense probably damaging 1.00
R0391:Olfr716 UTSW 7 107148187 nonsense probably null
R0962:Olfr716 UTSW 7 107148087 missense possibly damaging 0.94
R1440:Olfr716 UTSW 7 107148198 missense probably damaging 1.00
R5561:Olfr716 UTSW 7 107148090 missense probably benign 0.05
R5700:Olfr716 UTSW 7 107147541 missense probably benign
R5997:Olfr716 UTSW 7 107147328 missense possibly damaging 0.79
R6262:Olfr716 UTSW 7 107147711 missense probably damaging 1.00
R7076:Olfr716 UTSW 7 107148029 missense probably damaging 1.00
R8025:Olfr716 UTSW 7 107147723 missense possibly damaging 0.87
Z1088:Olfr716 UTSW 7 107148212 missense probably benign
Z1176:Olfr716 UTSW 7 107148155 missense probably benign 0.12
Predicted Primers PCR Primer
(F):5'- TGCAATGGGTGTGGTAATCC -3'
(R):5'- AAATCCTGCCCCATTTTCAAAG -3'

Sequencing Primer
(F):5'- GGTGTGGTAATCCTCCTAGCAC -3'
(R):5'- CCCTATAGGTCATTGCTTTCGAAAG -3'
Posted On2018-11-06