Incidental Mutation 'R6922:Lhfpl2'
ID539692
Institutional Source Beutler Lab
Gene Symbol Lhfpl2
Ensembl Gene ENSMUSG00000045312
Gene Namelipoma HMGIC fusion partner-like 2
Synonymsvgim
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.202) question?
Stock #R6922 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location94057796-94195409 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 94174521 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 100 (A100S)
Ref Sequence ENSEMBL: ENSMUSP00000152241 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054274] [ENSMUST00000118195] [ENSMUST00000120051] [ENSMUST00000121618] [ENSMUST00000156071] [ENSMUST00000221096] [ENSMUST00000223423]
Predicted Effect probably benign
Transcript: ENSMUST00000054274
AA Change: A100S

PolyPhen 2 Score 0.123 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000062239
Gene: ENSMUSG00000045312
AA Change: A100S

DomainStartEndE-ValueType
Pfam:L_HGMIC_fpl 9 198 2.3e-59 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000118195
AA Change: A100S

PolyPhen 2 Score 0.123 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000112655
Gene: ENSMUSG00000045312
AA Change: A100S

DomainStartEndE-ValueType
Pfam:L_HGMIC_fpl 9 198 2.4e-59 PFAM
Pfam:Claudin_2 16 197 3.9e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000120051
Predicted Effect probably benign
Transcript: ENSMUST00000121618
AA Change: A100S

PolyPhen 2 Score 0.123 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000113468
Gene: ENSMUSG00000045312
AA Change: A100S

DomainStartEndE-ValueType
Pfam:L_HGMIC_fpl 9 198 2.4e-59 PFAM
Pfam:Claudin_2 16 197 3.9e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000156071
AA Change: A100S

PolyPhen 2 Score 0.123 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000117113
Gene: ENSMUSG00000045312
AA Change: A100S

DomainStartEndE-ValueType
Pfam:L_HGMIC_fpl 9 139 2.3e-35 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000221096
Predicted Effect probably damaging
Transcript: ENSMUST00000223423
AA Change: A100S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.3859 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the lipoma HMGIC fusion partner (LHFP) gene family, which is a subset of the superfamily of tetraspan transmembrane protein encoding genes. Mutations in one LHFP-like gene result in deafness in humans and mice, and a second LHFP-like gene is fused to a high-mobility group gene in a translocation-associated lipoma. Alternatively spliced transcript variants have been found, but their biological validity has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Females homozygous for a spontaneous point mutation have a completely closed vagina, soft swelling of the perineum and buildup of viscous fluid in the uteri. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810013L24Rik A G 16: 8,830,689 probably null Het
Ago2 T C 15: 73,113,752 I665V probably benign Het
Arhgap32 A T 9: 32,152,687 M74L possibly damaging Het
Asb4 T C 6: 5,398,304 C90R possibly damaging Het
B3galt4 T A 17: 33,950,847 D139V probably damaging Het
Camta2 A C 11: 70,674,138 I852S probably benign Het
Cox4i2 G T 2: 152,757,095 E57D probably benign Het
Dip2b T C 15: 100,193,843 I1055T probably benign Het
Eif4g3 C T 4: 138,097,335 P284S probably damaging Het
Ephb1 C A 9: 101,929,264 probably null Het
Fbxw7 A T 3: 84,972,416 probably null Het
Frem1 C A 4: 82,922,269 D1789Y probably damaging Het
Gm16368 T A 12: 88,083,832 W46R probably benign Het
Gm29106 A T 1: 118,199,794 R405S probably damaging Het
Gm609 A T 16: 45,443,931 M88K probably benign Het
Greb1l G A 18: 10,547,482 V1567M possibly damaging Het
Heatr1 C A 13: 12,435,075 D1983E probably benign Het
Lrp5 A T 19: 3,605,301 V1073D probably damaging Het
Naip6 G A 13: 100,302,198 L364F possibly damaging Het
Nek9 A G 12: 85,303,537 L921P probably damaging Het
Nim1k C T 13: 119,727,727 E49K probably damaging Het
Nsun5 A C 5: 135,370,192 N32T probably damaging Het
Nuggc T C 14: 65,617,643 S325P probably damaging Het
Olfr1135 T A 2: 87,671,453 K305* probably null Het
Olfr716 A G 7: 107,148,083 I256V probably damaging Het
Pcdhga7 A G 18: 37,715,657 D239G probably damaging Het
Pld2 A G 11: 70,553,447 D523G probably benign Het
Prokr1 C A 6: 87,588,473 W130L probably damaging Het
Prpf8 A G 11: 75,490,736 N266S probably damaging Het
Rdh10 T C 1: 16,106,031 V5A probably benign Het
Rp1l1 T C 14: 64,030,385 L1140P possibly damaging Het
Sacs A G 14: 61,211,425 D3640G probably damaging Het
Smarca2 A G 19: 26,691,349 E916G probably damaging Het
Steap3 A T 1: 120,243,894 H160Q probably damaging Het
Svs1 T G 6: 48,987,574 F172C probably damaging Het
Tlk2 T C 11: 105,256,953 probably null Het
Tmprss4 A G 9: 45,185,922 V15A probably benign Het
Togaram2 T C 17: 71,707,134 L559P probably damaging Het
Topbp1 T A 9: 103,335,846 L990H probably damaging Het
Ttll7 A G 3: 146,909,614 T278A possibly damaging Het
Ttn G A 2: 76,774,436 L18385F probably damaging Het
Upf3a G T 8: 13,791,911 A149S probably damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Zfp316 A T 5: 143,253,525 F913Y probably damaging Het
Other mutations in Lhfpl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02106:Lhfpl2 APN 13 94191911 missense probably benign 0.00
IGL02576:Lhfpl2 APN 13 94174226 start codon destroyed probably null 1.00
R0278:Lhfpl2 UTSW 13 94174435 missense probably benign 0.00
R0482:Lhfpl2 UTSW 13 94174610 missense probably damaging 1.00
R1134:Lhfpl2 UTSW 13 94174252 missense probably damaging 1.00
R2130:Lhfpl2 UTSW 13 94192049 missense possibly damaging 0.91
R2302:Lhfpl2 UTSW 13 94174546 missense probably benign 0.00
R2995:Lhfpl2 UTSW 13 94174458 missense probably benign 0.04
R6613:Lhfpl2 UTSW 13 94174495 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGATCGGGAAAGCCAAGACC -3'
(R):5'- ACCAGAGGAACGGGATCTTG -3'

Sequencing Primer
(F):5'- GGAAAGCCAAGACCCGCAG -3'
(R):5'- TCTTCAACAGATGCAAGCAGTAAGTG -3'
Posted On2018-11-06