Incidental Mutation 'R6922:Dip2b'
ID 539699
Institutional Source Beutler Lab
Gene Symbol Dip2b
Ensembl Gene ENSMUSG00000023026
Gene Name disco interacting protein 2 homolog B
Synonyms
MMRRC Submission 045041-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.615) question?
Stock # R6922 (G1)
Quality Score 225.009
Status Not validated
Chromosome 15
Chromosomal Location 99936545-100117354 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 100091724 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 1055 (I1055T)
Ref Sequence ENSEMBL: ENSMUSP00000097777 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023768] [ENSMUST00000100203]
AlphaFold Q3UH60
Predicted Effect probably benign
Transcript: ENSMUST00000023768
AA Change: I821T

PolyPhen 2 Score 0.181 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000023768
Gene: ENSMUSG00000023026
AA Change: I821T

DomainStartEndE-ValueType
Pfam:AMP-binding 109 584 9.5e-26 PFAM
Pfam:AMP-binding 760 1235 1.2e-52 PFAM
low complexity region 1299 1311 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000100203
AA Change: I1055T

PolyPhen 2 Score 0.250 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000097777
Gene: ENSMUSG00000023026
AA Change: I1055T

DomainStartEndE-ValueType
DMAP_binding 12 130 1e-42 SMART
low complexity region 152 168 N/A INTRINSIC
low complexity region 181 192 N/A INTRINSIC
Pfam:AMP-binding 341 817 2e-26 PFAM
Pfam:AMP-binding 993 1468 1.8e-64 PFAM
low complexity region 1532 1544 N/A INTRINSIC
Meta Mutation Damage Score 0.0903 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the disco-interacting protein homolog 2 protein family. The encoded protein contains a binding site for the transcriptional regulator DNA methyltransferase 1 associated protein 1 as well as AMP-binding sites. The presence of these sites suggests that the encoded protein may participate in DNA methylation. This gene is located near a folate-sensitive fragile site, and CGG-repeat expansion in the promoter of this gene which affects transcription has been detected in individuals containing this fragile site on chromosome 12. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ago2 T C 15: 72,985,601 (GRCm39) I665V probably benign Het
Aoc1l3 T G 6: 48,964,508 (GRCm39) F172C probably damaging Het
Arhgap32 A T 9: 32,063,983 (GRCm39) M74L possibly damaging Het
Asb4 T C 6: 5,398,304 (GRCm39) C90R possibly damaging Het
B3galt4 T A 17: 34,169,821 (GRCm39) D139V probably damaging Het
Camta2 A C 11: 70,564,964 (GRCm39) I852S probably benign Het
Cd200l1 A T 16: 45,264,294 (GRCm39) M88K probably benign Het
Cox4i2 G T 2: 152,599,015 (GRCm39) E57D probably benign Het
Eif1ad18 T A 12: 88,050,602 (GRCm39) W46R probably benign Het
Eif4g3 C T 4: 137,824,646 (GRCm39) P284S probably damaging Het
Ephb1 C A 9: 101,806,463 (GRCm39) probably null Het
Fbxw7 A T 3: 84,879,723 (GRCm39) probably null Het
Frem1 C A 4: 82,840,506 (GRCm39) D1789Y probably damaging Het
Gm29106 A T 1: 118,127,524 (GRCm39) R405S probably damaging Het
Greb1l G A 18: 10,547,482 (GRCm39) V1567M possibly damaging Het
Hapstr1 A G 16: 8,648,553 (GRCm39) probably null Het
Heatr1 C A 13: 12,449,956 (GRCm39) D1983E probably benign Het
Lhfpl2 G T 13: 94,311,029 (GRCm39) A100S probably damaging Het
Lrp5 A T 19: 3,655,301 (GRCm39) V1073D probably damaging Het
Naip6 G A 13: 100,438,706 (GRCm39) L364F possibly damaging Het
Nek9 A G 12: 85,350,311 (GRCm39) L921P probably damaging Het
Nim1k C T 13: 120,189,263 (GRCm39) E49K probably damaging Het
Nsun5 A C 5: 135,399,046 (GRCm39) N32T probably damaging Het
Nuggc T C 14: 65,855,092 (GRCm39) S325P probably damaging Het
Or2d36 A G 7: 106,747,290 (GRCm39) I256V probably damaging Het
Or5w12 T A 2: 87,501,797 (GRCm39) K305* probably null Het
Pcdhga7 A G 18: 37,848,710 (GRCm39) D239G probably damaging Het
Pld2 A G 11: 70,444,273 (GRCm39) D523G probably benign Het
Prokr1 C A 6: 87,565,455 (GRCm39) W130L probably damaging Het
Prpf8 A G 11: 75,381,562 (GRCm39) N266S probably damaging Het
Rdh10 T C 1: 16,176,255 (GRCm39) V5A probably benign Het
Rp1l1 T C 14: 64,267,834 (GRCm39) L1140P possibly damaging Het
Sacs A G 14: 61,448,874 (GRCm39) D3640G probably damaging Het
Smarca2 A G 19: 26,668,749 (GRCm39) E916G probably damaging Het
Steap3 A T 1: 120,171,624 (GRCm39) H160Q probably damaging Het
Tlk2 T C 11: 105,147,779 (GRCm39) probably null Het
Tmprss4 A G 9: 45,097,220 (GRCm39) V15A probably benign Het
Togaram2 T C 17: 72,014,129 (GRCm39) L559P probably damaging Het
Topbp1 T A 9: 103,213,045 (GRCm39) L990H probably damaging Het
Ttll7 A G 3: 146,615,369 (GRCm39) T278A possibly damaging Het
Ttn G A 2: 76,604,780 (GRCm39) L18385F probably damaging Het
Upf3a G T 8: 13,841,911 (GRCm39) A149S probably damaging Het
Vmn2r111 T C 17: 22,778,032 (GRCm39) N549S possibly damaging Het
Zfp316 A T 5: 143,239,280 (GRCm39) F913Y probably damaging Het
Other mutations in Dip2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00515:Dip2b APN 15 100,072,382 (GRCm39) missense probably damaging 1.00
IGL01716:Dip2b APN 15 100,107,517 (GRCm39) missense probably benign 0.00
IGL01893:Dip2b APN 15 100,069,101 (GRCm39) splice site probably benign
IGL01915:Dip2b APN 15 100,076,392 (GRCm39) missense probably damaging 1.00
IGL02125:Dip2b APN 15 100,084,131 (GRCm39) missense possibly damaging 0.60
IGL02200:Dip2b APN 15 100,049,083 (GRCm39) missense possibly damaging 0.93
IGL02506:Dip2b APN 15 100,055,162 (GRCm39) missense probably damaging 1.00
IGL02571:Dip2b APN 15 100,055,766 (GRCm39) missense possibly damaging 0.93
IGL02706:Dip2b APN 15 100,113,192 (GRCm39) missense probably damaging 0.98
IGL02983:Dip2b APN 15 100,029,903 (GRCm39) missense possibly damaging 0.81
IGL03120:Dip2b APN 15 100,101,008 (GRCm39) splice site probably benign
IGL03181:Dip2b APN 15 100,113,088 (GRCm39) missense probably damaging 0.98
IGL03229:Dip2b APN 15 100,105,719 (GRCm39) splice site probably benign
IGL03399:Dip2b APN 15 100,073,208 (GRCm39) missense possibly damaging 0.63
PIT4131001:Dip2b UTSW 15 100,100,233 (GRCm39) missense probably damaging 1.00
R0009:Dip2b UTSW 15 100,067,193 (GRCm39) missense probably damaging 1.00
R0058:Dip2b UTSW 15 100,113,121 (GRCm39) missense probably benign 0.03
R0058:Dip2b UTSW 15 100,113,121 (GRCm39) missense probably benign 0.03
R0092:Dip2b UTSW 15 100,100,146 (GRCm39) missense probably damaging 1.00
R0201:Dip2b UTSW 15 100,084,028 (GRCm39) missense probably damaging 0.98
R0359:Dip2b UTSW 15 100,109,874 (GRCm39) missense probably damaging 0.98
R0390:Dip2b UTSW 15 100,091,794 (GRCm39) missense probably damaging 0.99
R0564:Dip2b UTSW 15 100,060,600 (GRCm39) nonsense probably null
R0730:Dip2b UTSW 15 100,069,532 (GRCm39) missense probably damaging 1.00
R1144:Dip2b UTSW 15 100,052,131 (GRCm39) missense probably benign 0.11
R1200:Dip2b UTSW 15 100,107,626 (GRCm39) missense probably benign 0.00
R1506:Dip2b UTSW 15 100,080,994 (GRCm39) missense probably damaging 1.00
R1750:Dip2b UTSW 15 100,076,347 (GRCm39) missense probably benign
R1760:Dip2b UTSW 15 100,109,910 (GRCm39) missense probably damaging 1.00
R1773:Dip2b UTSW 15 100,091,842 (GRCm39) missense probably benign 0.00
R1812:Dip2b UTSW 15 100,096,819 (GRCm39) splice site probably null
R2264:Dip2b UTSW 15 100,101,097 (GRCm39) missense probably benign 0.05
R3105:Dip2b UTSW 15 100,040,018 (GRCm39) nonsense probably null
R4029:Dip2b UTSW 15 100,084,053 (GRCm39) missense probably damaging 1.00
R4030:Dip2b UTSW 15 100,084,053 (GRCm39) missense probably damaging 1.00
R4296:Dip2b UTSW 15 100,079,217 (GRCm39) missense probably benign
R4392:Dip2b UTSW 15 100,059,917 (GRCm39) missense probably damaging 1.00
R4480:Dip2b UTSW 15 100,084,182 (GRCm39) missense probably damaging 0.99
R4564:Dip2b UTSW 15 100,055,139 (GRCm39) nonsense probably null
R4605:Dip2b UTSW 15 100,107,517 (GRCm39) missense probably benign 0.00
R4606:Dip2b UTSW 15 100,113,210 (GRCm39) missense possibly damaging 0.91
R4634:Dip2b UTSW 15 100,058,372 (GRCm39) missense probably damaging 1.00
R4667:Dip2b UTSW 15 100,049,241 (GRCm39) missense probably benign 0.01
R4739:Dip2b UTSW 15 100,105,658 (GRCm39) missense probably damaging 0.98
R4826:Dip2b UTSW 15 100,067,162 (GRCm39) missense probably damaging 0.99
R4870:Dip2b UTSW 15 100,093,665 (GRCm39) splice site probably null
R4877:Dip2b UTSW 15 100,058,410 (GRCm39) missense possibly damaging 0.49
R4932:Dip2b UTSW 15 100,069,603 (GRCm39) missense probably damaging 1.00
R5009:Dip2b UTSW 15 100,093,665 (GRCm39) splice site probably null
R5169:Dip2b UTSW 15 100,102,994 (GRCm39) missense probably damaging 1.00
R5216:Dip2b UTSW 15 100,109,867 (GRCm39) missense probably damaging 1.00
R5218:Dip2b UTSW 15 100,052,177 (GRCm39) missense probably benign 0.00
R5274:Dip2b UTSW 15 100,109,985 (GRCm39) missense possibly damaging 0.54
R5370:Dip2b UTSW 15 100,109,867 (GRCm39) missense probably damaging 1.00
R5420:Dip2b UTSW 15 100,103,054 (GRCm39) intron probably benign
R5447:Dip2b UTSW 15 100,109,867 (GRCm39) missense probably damaging 1.00
R5670:Dip2b UTSW 15 100,087,985 (GRCm39) missense possibly damaging 0.80
R5768:Dip2b UTSW 15 100,055,826 (GRCm39) missense probably benign 0.32
R5908:Dip2b UTSW 15 100,049,065 (GRCm39) missense possibly damaging 0.93
R5957:Dip2b UTSW 15 100,107,575 (GRCm39) missense probably benign 0.03
R5987:Dip2b UTSW 15 100,087,960 (GRCm39) missense probably damaging 1.00
R6260:Dip2b UTSW 15 100,060,583 (GRCm39) missense probably benign 0.05
R6325:Dip2b UTSW 15 100,052,163 (GRCm39) missense probably benign 0.00
R6367:Dip2b UTSW 15 100,013,795 (GRCm39) missense possibly damaging 0.50
R6391:Dip2b UTSW 15 100,049,157 (GRCm39) missense probably damaging 1.00
R6422:Dip2b UTSW 15 100,096,892 (GRCm39) missense probably damaging 0.98
R6818:Dip2b UTSW 15 100,091,835 (GRCm39) missense probably benign 0.09
R7002:Dip2b UTSW 15 100,058,346 (GRCm39) missense probably benign 0.43
R7076:Dip2b UTSW 15 100,055,853 (GRCm39) splice site probably null
R7176:Dip2b UTSW 15 100,067,199 (GRCm39) missense probably damaging 1.00
R7255:Dip2b UTSW 15 100,107,508 (GRCm39) missense probably benign 0.00
R7463:Dip2b UTSW 15 100,052,038 (GRCm39) missense probably benign
R7513:Dip2b UTSW 15 100,105,629 (GRCm39) splice site probably null
R7876:Dip2b UTSW 15 100,088,922 (GRCm39) missense probably benign 0.02
R8368:Dip2b UTSW 15 100,052,124 (GRCm39) missense probably benign 0.00
R9289:Dip2b UTSW 15 100,071,152 (GRCm39) missense probably damaging 0.97
R9405:Dip2b UTSW 15 100,093,757 (GRCm39) missense probably benign 0.05
R9477:Dip2b UTSW 15 99,936,784 (GRCm39) missense probably damaging 1.00
R9485:Dip2b UTSW 15 100,052,924 (GRCm39) missense probably benign 0.05
R9533:Dip2b UTSW 15 100,073,178 (GRCm39) missense probably benign 0.06
R9581:Dip2b UTSW 15 100,079,255 (GRCm39) missense probably damaging 0.99
R9666:Dip2b UTSW 15 100,107,461 (GRCm39) missense probably damaging 1.00
X0064:Dip2b UTSW 15 100,013,731 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGTCTAAGCTACATGAACCAGG -3'
(R):5'- ACTACTTGACACTAAGGAAGCAAG -3'

Sequencing Primer
(F):5'- ATATGCAGCCCACATGTC -3'
(R):5'- CTTGACACTAAGGAAGCAAGAAGTG -3'
Posted On 2018-11-06