Incidental Mutation 'R6923:Gpatch3'
ID 539726
Institutional Source Beutler Lab
Gene Symbol Gpatch3
Ensembl Gene ENSMUSG00000028850
Gene Name G patch domain containing 3
Synonyms Gpatc3, D930035B09Rik
MMRRC Submission 045381-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.074) question?
Stock # R6923 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 133302056-133311553 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 133309836 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Phenylalanine at position 390 (L390F)
Ref Sequence ENSEMBL: ENSMUSP00000030662 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030661] [ENSMUST00000030662] [ENSMUST00000105899]
AlphaFold Q8BIY1
Predicted Effect probably benign
Transcript: ENSMUST00000030661
SMART Domains Protein: ENSMUSP00000030661
Gene: ENSMUSG00000028848

DomainStartEndE-ValueType
Pfam:ATP_bind_1 14 261 6.6e-81 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000030662
AA Change: L390F

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000030662
Gene: ENSMUSG00000028850
AA Change: L390F

DomainStartEndE-ValueType
low complexity region 83 97 N/A INTRINSIC
low complexity region 274 305 N/A INTRINSIC
G_patch 409 457 1.3e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105899
SMART Domains Protein: ENSMUSP00000101519
Gene: ENSMUSG00000028848

DomainStartEndE-ValueType
Pfam:ATP_bind_1 14 117 9.2e-42 PFAM
Pfam:ATP_bind_1 115 238 4.3e-28 PFAM
Meta Mutation Damage Score 0.1022 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.4%
Validation Efficiency 100% (59/59)
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Albfm1 A G 5: 90,725,652 (GRCm39) N288S probably benign Het
Ap4b1 T A 3: 103,719,530 (GRCm39) D81E probably benign Het
Atg16l1 A T 1: 87,702,078 (GRCm39) probably null Het
Atp11a A G 8: 12,906,949 (GRCm39) T459A probably damaging Het
Bloc1s5 T A 13: 38,815,040 (GRCm39) I40F probably damaging Het
Bltp2 T A 11: 78,165,452 (GRCm39) S1323T possibly damaging Het
Capn5 T A 7: 97,778,461 (GRCm39) Q386L probably damaging Het
Cbfa2t2 C T 2: 154,376,903 (GRCm39) H529Y probably damaging Het
Cd3d T C 9: 44,897,157 (GRCm39) probably benign Het
Cenpa A G 5: 30,829,806 (GRCm39) probably null Het
Chit1 A T 1: 134,077,163 (GRCm39) Y322F probably null Het
Cntnap5c T A 17: 58,399,345 (GRCm39) N399K possibly damaging Het
Dock8 A T 19: 25,072,970 (GRCm39) T417S probably benign Het
Firrm A G 1: 163,814,454 (GRCm39) probably null Het
Fkbp2 A G 19: 6,956,537 (GRCm39) Het
Fsip1 G A 2: 118,080,394 (GRCm39) R121C probably benign Het
Gbp2b T C 3: 142,306,320 (GRCm39) I131T probably benign Het
Gm12695 T C 4: 96,658,053 (GRCm39) N39D probably benign Het
Gm4922 T C 10: 18,659,616 (GRCm39) R369G probably damaging Het
Gpd2 G A 2: 57,245,800 (GRCm39) M443I probably damaging Het
Gpt2 G A 8: 86,244,681 (GRCm39) E325K probably benign Het
Hdac1-ps A G 17: 78,800,343 (GRCm39) T445A possibly damaging Het
Jph3 A G 8: 122,480,110 (GRCm39) T263A possibly damaging Het
Me3 C A 7: 89,495,093 (GRCm39) A337E probably damaging Het
Mndal A C 1: 173,712,264 (GRCm39) probably null Het
Msantd5l C T 11: 51,144,808 (GRCm39) D158N probably damaging Het
Muc6 C T 7: 141,217,453 (GRCm39) E2342K possibly damaging Het
Neb A G 2: 52,076,076 (GRCm39) V5659A probably damaging Het
Nkapd1 T A 9: 50,521,610 (GRCm39) I104L probably benign Het
Nrxn1 G A 17: 91,395,661 (GRCm39) A165V probably benign Het
Or5b94 T A 19: 12,652,409 (GRCm39) I280N possibly damaging Het
Or5b97 T C 19: 12,878,676 (GRCm39) N156S probably benign Het
Orc2 A G 1: 58,539,534 (GRCm39) L35S probably benign Het
Pax4 A G 6: 28,447,118 (GRCm39) probably null Het
Pcdhb7 C T 18: 37,475,522 (GRCm39) probably null Het
Pla2r1 C T 2: 60,345,310 (GRCm39) E349K probably benign Het
Polr2a C T 11: 69,626,787 (GRCm39) A1516T probably benign Het
Pramel23 A T 4: 143,425,676 (GRCm39) I89N probably benign Het
Prpf38a G T 4: 108,427,401 (GRCm39) D187E possibly damaging Het
Rdh16f1 T A 10: 127,624,737 (GRCm39) probably null Het
S100z T A 13: 95,615,090 (GRCm39) D25V probably damaging Het
Scamp2 T G 9: 57,488,895 (GRCm39) F199V probably damaging Het
Semp2l2b C A 10: 21,943,654 (GRCm39) G109C probably damaging Het
Senp2 T G 16: 21,830,326 (GRCm39) probably benign Het
Sltm T A 9: 70,481,892 (GRCm39) S365T probably damaging Het
Smg6 C G 11: 74,820,169 (GRCm39) P147A possibly damaging Het
Spem2 T A 11: 69,708,603 (GRCm39) R121W probably damaging Het
Sufu A G 19: 46,439,405 (GRCm39) probably null Het
Syt2 T C 1: 134,674,501 (GRCm39) V313A possibly damaging Het
Tet2 C T 3: 133,185,102 (GRCm39) probably null Het
Tfeb T A 17: 48,097,908 (GRCm39) I232N probably benign Het
Ticrr T G 7: 79,341,601 (GRCm39) I1062M probably damaging Het
Vmn2r111 T C 17: 22,778,032 (GRCm39) N549S possibly damaging Het
Vrk2 G A 11: 26,439,893 (GRCm39) A226V probably damaging Het
Wnk1 A T 6: 119,942,639 (GRCm39) probably benign Het
Xpo4 G T 14: 57,841,168 (GRCm39) T505K probably benign Het
Yy1 A T 12: 108,759,594 (GRCm39) I86F probably benign Het
Zc3h15 A G 2: 83,487,400 (GRCm39) D73G possibly damaging Het
Other mutations in Gpatch3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01590:Gpatch3 APN 4 133,308,028 (GRCm39) unclassified probably benign
IGL02876:Gpatch3 APN 4 133,307,995 (GRCm39) missense probably damaging 1.00
IGL03181:Gpatch3 APN 4 133,305,433 (GRCm39) missense probably damaging 1.00
ANU23:Gpatch3 UTSW 4 133,305,613 (GRCm39) small deletion probably benign
PIT4585001:Gpatch3 UTSW 4 133,310,397 (GRCm39) missense probably damaging 0.99
R0358:Gpatch3 UTSW 4 133,305,215 (GRCm39) splice site probably null
R0383:Gpatch3 UTSW 4 133,305,457 (GRCm39) missense probably damaging 1.00
R1706:Gpatch3 UTSW 4 133,302,484 (GRCm39) nonsense probably null
R2269:Gpatch3 UTSW 4 133,311,118 (GRCm39) missense possibly damaging 0.83
R3788:Gpatch3 UTSW 4 133,302,479 (GRCm39) missense possibly damaging 0.93
R4030:Gpatch3 UTSW 4 133,305,458 (GRCm39) missense possibly damaging 0.94
R4334:Gpatch3 UTSW 4 133,309,792 (GRCm39) missense probably damaging 1.00
R4718:Gpatch3 UTSW 4 133,309,855 (GRCm39) missense probably benign 0.37
R5036:Gpatch3 UTSW 4 133,305,461 (GRCm39) missense probably damaging 1.00
R6032:Gpatch3 UTSW 4 133,305,617 (GRCm39) missense probably benign 0.06
R6032:Gpatch3 UTSW 4 133,305,617 (GRCm39) missense probably benign 0.06
R6572:Gpatch3 UTSW 4 133,302,191 (GRCm39) missense probably damaging 1.00
R7106:Gpatch3 UTSW 4 133,305,514 (GRCm39) missense probably benign 0.05
R7572:Gpatch3 UTSW 4 133,302,117 (GRCm39) missense probably benign 0.01
R7737:Gpatch3 UTSW 4 133,302,407 (GRCm39) missense probably benign 0.01
R7937:Gpatch3 UTSW 4 133,310,308 (GRCm39) missense probably damaging 0.98
R8300:Gpatch3 UTSW 4 133,307,140 (GRCm39) missense probably damaging 1.00
R9541:Gpatch3 UTSW 4 133,305,595 (GRCm39) missense probably benign 0.01
RF025:Gpatch3 UTSW 4 133,305,621 (GRCm39) frame shift probably null
Predicted Primers PCR Primer
(F):5'- CCAAGGTTCCTGTTCCTGTTGG -3'
(R):5'- AAGTGGCTCAAGTGTGGCAG -3'

Sequencing Primer
(F):5'- GTTCCTGTTGGGCTCCC -3'
(R):5'- CACTCACTTACCTTGGTG -3'
Posted On 2018-11-06