Incidental Mutation 'R6923:Ticrr'
ID 539732
Institutional Source Beutler Lab
Gene Symbol Ticrr
Ensembl Gene ENSMUSG00000046591
Gene Name TOPBP1-interacting checkpoint and replication regulator
Synonyms 5730590G19Rik
MMRRC Submission 045381-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.948) question?
Stock # R6923 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 79309944-79347896 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 79341601 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Methionine at position 1062 (I1062M)
Ref Sequence ENSEMBL: ENSMUSP00000041377 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035977] [ENSMUST00000206591] [ENSMUST00000206622]
AlphaFold Q8BQ33
Predicted Effect probably damaging
Transcript: ENSMUST00000035977
AA Change: I1062M

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000041377
Gene: ENSMUSG00000046591
AA Change: I1062M

DomainStartEndE-ValueType
low complexity region 23 31 N/A INTRINSIC
Pfam:Treslin_N 211 1005 N/A PFAM
low complexity region 1186 1197 N/A INTRINSIC
low complexity region 1220 1235 N/A INTRINSIC
low complexity region 1339 1359 N/A INTRINSIC
low complexity region 1472 1480 N/A INTRINSIC
low complexity region 1496 1514 N/A INTRINSIC
low complexity region 1630 1643 N/A INTRINSIC
low complexity region 1694 1707 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000206591
Predicted Effect probably benign
Transcript: ENSMUST00000206622
Meta Mutation Damage Score 0.0663 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.4%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Treslin is involved in the initiation of DNA replication (Kumagai et al., 2010 [PubMed 20116089]).[supplied by OMIM, Apr 2010]
PHENOTYPE: Mice homozygous for an ENU-induced allele are mostly hairless, with only a light patch of hair around the face and tail. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Albfm1 A G 5: 90,725,652 (GRCm39) N288S probably benign Het
Ap4b1 T A 3: 103,719,530 (GRCm39) D81E probably benign Het
Atg16l1 A T 1: 87,702,078 (GRCm39) probably null Het
Atp11a A G 8: 12,906,949 (GRCm39) T459A probably damaging Het
Bloc1s5 T A 13: 38,815,040 (GRCm39) I40F probably damaging Het
Bltp2 T A 11: 78,165,452 (GRCm39) S1323T possibly damaging Het
Capn5 T A 7: 97,778,461 (GRCm39) Q386L probably damaging Het
Cbfa2t2 C T 2: 154,376,903 (GRCm39) H529Y probably damaging Het
Cd3d T C 9: 44,897,157 (GRCm39) probably benign Het
Cenpa A G 5: 30,829,806 (GRCm39) probably null Het
Chit1 A T 1: 134,077,163 (GRCm39) Y322F probably null Het
Cntnap5c T A 17: 58,399,345 (GRCm39) N399K possibly damaging Het
Dock8 A T 19: 25,072,970 (GRCm39) T417S probably benign Het
Firrm A G 1: 163,814,454 (GRCm39) probably null Het
Fkbp2 A G 19: 6,956,537 (GRCm39) Het
Fsip1 G A 2: 118,080,394 (GRCm39) R121C probably benign Het
Gbp2b T C 3: 142,306,320 (GRCm39) I131T probably benign Het
Gm12695 T C 4: 96,658,053 (GRCm39) N39D probably benign Het
Gm4922 T C 10: 18,659,616 (GRCm39) R369G probably damaging Het
Gpatch3 C T 4: 133,309,836 (GRCm39) L390F probably damaging Het
Gpd2 G A 2: 57,245,800 (GRCm39) M443I probably damaging Het
Gpt2 G A 8: 86,244,681 (GRCm39) E325K probably benign Het
Hdac1-ps A G 17: 78,800,343 (GRCm39) T445A possibly damaging Het
Jph3 A G 8: 122,480,110 (GRCm39) T263A possibly damaging Het
Me3 C A 7: 89,495,093 (GRCm39) A337E probably damaging Het
Mndal A C 1: 173,712,264 (GRCm39) probably null Het
Msantd5l C T 11: 51,144,808 (GRCm39) D158N probably damaging Het
Muc6 C T 7: 141,217,453 (GRCm39) E2342K possibly damaging Het
Neb A G 2: 52,076,076 (GRCm39) V5659A probably damaging Het
Nkapd1 T A 9: 50,521,610 (GRCm39) I104L probably benign Het
Nrxn1 G A 17: 91,395,661 (GRCm39) A165V probably benign Het
Or5b94 T A 19: 12,652,409 (GRCm39) I280N possibly damaging Het
Or5b97 T C 19: 12,878,676 (GRCm39) N156S probably benign Het
Orc2 A G 1: 58,539,534 (GRCm39) L35S probably benign Het
Pax4 A G 6: 28,447,118 (GRCm39) probably null Het
Pcdhb7 C T 18: 37,475,522 (GRCm39) probably null Het
Pla2r1 C T 2: 60,345,310 (GRCm39) E349K probably benign Het
Polr2a C T 11: 69,626,787 (GRCm39) A1516T probably benign Het
Pramel23 A T 4: 143,425,676 (GRCm39) I89N probably benign Het
Prpf38a G T 4: 108,427,401 (GRCm39) D187E possibly damaging Het
Rdh16f1 T A 10: 127,624,737 (GRCm39) probably null Het
S100z T A 13: 95,615,090 (GRCm39) D25V probably damaging Het
Scamp2 T G 9: 57,488,895 (GRCm39) F199V probably damaging Het
Semp2l2b C A 10: 21,943,654 (GRCm39) G109C probably damaging Het
Senp2 T G 16: 21,830,326 (GRCm39) probably benign Het
Sltm T A 9: 70,481,892 (GRCm39) S365T probably damaging Het
Smg6 C G 11: 74,820,169 (GRCm39) P147A possibly damaging Het
Spem2 T A 11: 69,708,603 (GRCm39) R121W probably damaging Het
Sufu A G 19: 46,439,405 (GRCm39) probably null Het
Syt2 T C 1: 134,674,501 (GRCm39) V313A possibly damaging Het
Tet2 C T 3: 133,185,102 (GRCm39) probably null Het
Tfeb T A 17: 48,097,908 (GRCm39) I232N probably benign Het
Vmn2r111 T C 17: 22,778,032 (GRCm39) N549S possibly damaging Het
Vrk2 G A 11: 26,439,893 (GRCm39) A226V probably damaging Het
Wnk1 A T 6: 119,942,639 (GRCm39) probably benign Het
Xpo4 G T 14: 57,841,168 (GRCm39) T505K probably benign Het
Yy1 A T 12: 108,759,594 (GRCm39) I86F probably benign Het
Zc3h15 A G 2: 83,487,400 (GRCm39) D73G possibly damaging Het
Other mutations in Ticrr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Ticrr APN 7 79,327,031 (GRCm39) missense probably damaging 1.00
IGL00596:Ticrr APN 7 79,327,041 (GRCm39) missense probably damaging 1.00
IGL01327:Ticrr APN 7 79,344,209 (GRCm39) missense probably benign 0.00
IGL01525:Ticrr APN 7 79,332,197 (GRCm39) missense probably damaging 1.00
IGL01565:Ticrr APN 7 79,344,296 (GRCm39) missense probably benign
IGL01936:Ticrr APN 7 79,344,297 (GRCm39) missense probably benign 0.11
IGL02160:Ticrr APN 7 79,343,767 (GRCm39) missense probably benign 0.29
IGL02246:Ticrr APN 7 79,325,076 (GRCm39) missense probably damaging 1.00
IGL02487:Ticrr APN 7 79,332,769 (GRCm39) missense possibly damaging 0.86
IGL02593:Ticrr APN 7 79,345,214 (GRCm39) missense probably damaging 0.99
IGL02970:Ticrr APN 7 79,344,919 (GRCm39) missense probably benign 0.01
FR4304:Ticrr UTSW 7 79,344,059 (GRCm39) intron probably benign
PIT4305001:Ticrr UTSW 7 79,328,771 (GRCm39) missense possibly damaging 0.95
PIT4791001:Ticrr UTSW 7 79,319,386 (GRCm39) missense possibly damaging 0.92
R0016:Ticrr UTSW 7 79,343,540 (GRCm39) missense probably benign 0.01
R0062:Ticrr UTSW 7 79,317,654 (GRCm39) missense probably benign 0.01
R0062:Ticrr UTSW 7 79,317,654 (GRCm39) missense probably benign 0.01
R0067:Ticrr UTSW 7 79,327,158 (GRCm39) missense probably damaging 1.00
R0067:Ticrr UTSW 7 79,327,158 (GRCm39) missense probably damaging 1.00
R0362:Ticrr UTSW 7 79,327,088 (GRCm39) missense probably damaging 1.00
R0482:Ticrr UTSW 7 79,344,236 (GRCm39) missense probably damaging 0.99
R0595:Ticrr UTSW 7 79,345,311 (GRCm39) missense possibly damaging 0.94
R1118:Ticrr UTSW 7 79,343,701 (GRCm39) missense probably benign 0.23
R1119:Ticrr UTSW 7 79,343,701 (GRCm39) missense probably benign 0.23
R1572:Ticrr UTSW 7 79,331,572 (GRCm39) missense probably damaging 1.00
R1658:Ticrr UTSW 7 79,345,297 (GRCm39) missense possibly damaging 0.57
R1757:Ticrr UTSW 7 79,328,794 (GRCm39) nonsense probably null
R1757:Ticrr UTSW 7 79,325,071 (GRCm39) missense probably damaging 0.99
R1862:Ticrr UTSW 7 79,344,955 (GRCm39) missense probably damaging 1.00
R1869:Ticrr UTSW 7 79,328,883 (GRCm39) missense probably damaging 1.00
R1938:Ticrr UTSW 7 79,325,142 (GRCm39) missense probably damaging 0.98
R1966:Ticrr UTSW 7 79,344,483 (GRCm39) nonsense probably null
R2006:Ticrr UTSW 7 79,343,821 (GRCm39) missense possibly damaging 0.93
R2178:Ticrr UTSW 7 79,315,433 (GRCm39) missense probably benign 0.12
R3404:Ticrr UTSW 7 79,344,539 (GRCm39) missense probably benign 0.06
R3405:Ticrr UTSW 7 79,344,539 (GRCm39) missense probably benign 0.06
R3941:Ticrr UTSW 7 79,343,445 (GRCm39) intron probably benign
R3950:Ticrr UTSW 7 79,331,817 (GRCm39) missense probably damaging 1.00
R3951:Ticrr UTSW 7 79,331,817 (GRCm39) missense probably damaging 1.00
R3952:Ticrr UTSW 7 79,331,817 (GRCm39) missense probably damaging 1.00
R4967:Ticrr UTSW 7 79,310,158 (GRCm39) missense probably damaging 0.99
R4972:Ticrr UTSW 7 79,319,416 (GRCm39) missense probably damaging 0.98
R5259:Ticrr UTSW 7 79,344,471 (GRCm39) missense probably benign 0.01
R5272:Ticrr UTSW 7 79,319,353 (GRCm39) missense probably benign 0.44
R5374:Ticrr UTSW 7 79,340,690 (GRCm39) nonsense probably null
R5480:Ticrr UTSW 7 79,310,557 (GRCm39) missense probably damaging 1.00
R5568:Ticrr UTSW 7 79,345,044 (GRCm39) nonsense probably null
R5568:Ticrr UTSW 7 79,339,715 (GRCm39) critical splice donor site probably null
R5588:Ticrr UTSW 7 79,328,853 (GRCm39) missense probably damaging 1.00
R5698:Ticrr UTSW 7 79,328,881 (GRCm39) missense probably benign
R5879:Ticrr UTSW 7 79,346,438 (GRCm39) missense probably benign 0.12
R5980:Ticrr UTSW 7 79,310,703 (GRCm39) missense probably damaging 0.99
R6128:Ticrr UTSW 7 79,343,716 (GRCm39) missense probably damaging 1.00
R6277:Ticrr UTSW 7 79,344,444 (GRCm39) missense probably benign 0.00
R6335:Ticrr UTSW 7 79,344,031 (GRCm39) splice site probably null
R6866:Ticrr UTSW 7 79,343,705 (GRCm39) missense possibly damaging 0.47
R6905:Ticrr UTSW 7 79,315,598 (GRCm39) missense probably benign 0.00
R6962:Ticrr UTSW 7 79,315,645 (GRCm39) missense possibly damaging 0.84
R7232:Ticrr UTSW 7 79,343,490 (GRCm39) missense probably damaging 0.96
R7285:Ticrr UTSW 7 79,310,610 (GRCm39) missense possibly damaging 0.93
R7385:Ticrr UTSW 7 79,341,597 (GRCm39) missense possibly damaging 0.93
R7426:Ticrr UTSW 7 79,343,734 (GRCm39) missense probably benign
R7583:Ticrr UTSW 7 79,346,487 (GRCm39) nonsense probably null
R7749:Ticrr UTSW 7 79,328,844 (GRCm39) missense possibly damaging 0.94
R7863:Ticrr UTSW 7 79,331,760 (GRCm39) missense possibly damaging 0.92
R7899:Ticrr UTSW 7 79,319,233 (GRCm39) missense probably benign 0.23
R7935:Ticrr UTSW 7 79,331,584 (GRCm39) missense probably damaging 0.99
R8005:Ticrr UTSW 7 79,343,796 (GRCm39) missense probably damaging 0.98
R8080:Ticrr UTSW 7 79,334,012 (GRCm39) splice site probably null
R8181:Ticrr UTSW 7 79,310,728 (GRCm39) missense possibly damaging 0.92
R8349:Ticrr UTSW 7 79,344,428 (GRCm39) missense probably benign 0.27
R8410:Ticrr UTSW 7 79,317,423 (GRCm39) missense probably damaging 0.98
R8449:Ticrr UTSW 7 79,344,428 (GRCm39) missense probably benign 0.27
R9073:Ticrr UTSW 7 79,317,679 (GRCm39) missense probably benign 0.01
R9090:Ticrr UTSW 7 79,310,604 (GRCm39) missense possibly damaging 0.85
R9271:Ticrr UTSW 7 79,310,604 (GRCm39) missense possibly damaging 0.85
R9287:Ticrr UTSW 7 79,343,516 (GRCm39) missense possibly damaging 0.89
R9368:Ticrr UTSW 7 79,330,735 (GRCm39) missense probably damaging 0.99
R9469:Ticrr UTSW 7 79,344,511 (GRCm39) missense probably benign 0.03
R9502:Ticrr UTSW 7 79,343,597 (GRCm39) missense probably benign
R9614:Ticrr UTSW 7 79,345,754 (GRCm39) missense probably damaging 1.00
R9761:Ticrr UTSW 7 79,345,313 (GRCm39) missense probably damaging 1.00
R9779:Ticrr UTSW 7 79,328,802 (GRCm39) missense probably benign 0.37
Predicted Primers PCR Primer
(F):5'- AAATCAGTTACTTCAGTTGCTCCC -3'
(R):5'- ATGTTCCCCAAGACTGCACC -3'

Sequencing Primer
(F):5'- AGAGGTCCTGAGTTCAATTCCCAG -3'
(R):5'- TTCCCCAAGACTGCACCATTTTAAAC -3'
Posted On 2018-11-06