Incidental Mutation 'R6924:Stk17b'
ID 539765
Institutional Source Beutler Lab
Gene Symbol Stk17b
Ensembl Gene ENSMUSG00000026094
Gene Name serine/threonine kinase 17b (apoptosis-inducing)
Synonyms 3110009A03Rik, Drak2
MMRRC Submission 045042-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.092) question?
Stock # R6924 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 53794671-53824374 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 53800218 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 253 (D253E)
Ref Sequence ENSEMBL: ENSMUSP00000027263 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027263] [ENSMUST00000185920]
AlphaFold Q8BG48
Predicted Effect possibly damaging
Transcript: ENSMUST00000027263
AA Change: D253E

PolyPhen 2 Score 0.537 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000027263
Gene: ENSMUSG00000026094
AA Change: D253E

DomainStartEndE-ValueType
S_TKc 33 293 5.77e-79 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000185920
SMART Domains Protein: ENSMUSP00000139880
Gene: ENSMUSG00000026094

DomainStartEndE-ValueType
S_TKc 1 93 5.8e-5 SMART
Meta Mutation Damage Score 0.0698 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.8%
Validation Efficiency 98% (54/55)
MGI Phenotype PHENOTYPE: Homozygous null mice display abnormal T cell numbers, increased T cell proliferation, abnormal cytokine physiology, and decreased susceptibility to experimental autoimmune encephalomyelitis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700009N14Rik A C 4: 39,450,884 (GRCm39) H30P probably damaging Het
Abhd6 A T 14: 8,049,850 (GRCm38) H213L possibly damaging Het
Adam22 T A 5: 8,417,322 (GRCm39) N40I possibly damaging Het
Ankrd42 A G 7: 92,231,224 (GRCm39) probably benign Het
Arhgap40 C T 2: 158,369,066 (GRCm39) R63C probably benign Het
Atf7ip T G 6: 136,536,755 (GRCm39) probably null Het
Atg7 T C 6: 114,686,172 (GRCm39) probably null Het
Car6 A C 4: 150,273,713 (GRCm39) probably null Het
Carmil1 A T 13: 24,259,667 (GRCm39) C302* probably null Het
Ccdc117 A T 11: 5,484,255 (GRCm39) M195K probably benign Het
Cep95 T C 11: 106,702,023 (GRCm39) M383T probably damaging Het
Col20a1 A G 2: 180,638,643 (GRCm39) E419G probably damaging Het
Cyp2d9 C G 15: 82,339,413 (GRCm39) R272G probably damaging Het
Dhx57 A T 17: 80,546,244 (GRCm39) M1380K possibly damaging Het
Dnah14 A G 1: 181,455,517 (GRCm39) S881G probably benign Het
Fcgbp T A 7: 27,793,248 (GRCm39) I1084N probably benign Het
Fgf17 A T 14: 70,878,981 (GRCm39) C21* probably null Het
Gemin4 A G 11: 76,103,162 (GRCm39) L533P probably damaging Het
Gkn3 T C 6: 87,365,784 (GRCm39) R12G probably benign Het
Gpr161 G T 1: 165,149,188 (GRCm39) R519L possibly damaging Het
Grin2a A G 16: 9,481,092 (GRCm39) V535A possibly damaging Het
Gys1 G A 7: 45,093,059 (GRCm39) probably null Het
Hfm1 C T 5: 106,998,276 (GRCm39) probably null Het
Hmcn2 T A 2: 31,240,517 (GRCm39) probably null Het
Hnrnpul2 T C 19: 8,808,873 (GRCm39) Y738H unknown Het
Hycc1 T C 5: 24,191,133 (GRCm39) probably null Het
Igsf23 A G 7: 19,675,684 (GRCm39) S141P possibly damaging Het
Lamc3 A C 2: 31,828,081 (GRCm39) M1423L probably benign Het
Lcmt2 T C 2: 120,970,484 (GRCm39) T200A probably benign Het
Lgr4 T C 2: 109,842,784 (GRCm39) V899A probably damaging Het
Macf1 T A 4: 123,421,145 (GRCm39) R36S possibly damaging Het
Mrgprb8 A G 7: 48,038,871 (GRCm39) K181E possibly damaging Het
Muc2 G A 7: 141,284,077 (GRCm39) V786M possibly damaging Het
Nacc2 T C 2: 25,980,041 (GRCm39) T132A probably damaging Het
Nsmce2 T A 15: 59,250,774 (GRCm39) I15K probably damaging Het
Or10p22 T G 10: 128,825,960 (GRCm39) Y60D probably damaging Het
Or4k15c A G 14: 50,321,307 (GRCm39) I277T possibly damaging Het
Otoa A T 7: 120,730,724 (GRCm39) probably null Het
Otogl A G 10: 107,644,502 (GRCm39) I1248T probably damaging Het
Ppp1r17 T A 6: 56,003,007 (GRCm39) D32E probably damaging Het
Relt A C 7: 100,496,468 (GRCm39) V427G probably damaging Het
Ric1 T A 19: 29,546,788 (GRCm39) V256D probably damaging Het
Samhd1 T C 2: 156,951,403 (GRCm39) T445A probably benign Het
Sepsecs T C 5: 52,821,646 (GRCm39) I189V probably benign Het
Shroom3 T A 5: 93,112,262 (GRCm39) D1793E probably damaging Het
Sim1 C T 10: 50,784,635 (GRCm39) T137I probably benign Het
Stmnd1 T C 13: 46,452,969 (GRCm39) V215A probably benign Het
Tcl1 A G 12: 105,185,015 (GRCm39) L65P probably damaging Het
Tiam2 A C 17: 3,558,070 (GRCm39) K1231N probably damaging Het
Tm9sf3 T C 19: 41,206,717 (GRCm39) Y476C probably damaging Het
Trim63 T C 4: 134,048,572 (GRCm39) S194P probably damaging Het
Ugt1a10 T A 1: 87,983,379 (GRCm39) I59N probably damaging Het
Vmn2r65 A G 7: 84,613,198 (GRCm39) F7S probably benign Het
Zfp775 T A 6: 48,596,589 (GRCm39) H154Q probably damaging Het
Zfp804b C T 5: 6,819,902 (GRCm39) V1018I probably benign Het
Other mutations in Stk17b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00722:Stk17b APN 1 53,803,299 (GRCm39) missense probably damaging 0.99
IGL00767:Stk17b APN 1 53,803,182 (GRCm39) splice site probably benign
IGL01012:Stk17b APN 1 53,800,196 (GRCm39) missense probably benign 0.06
IGL01431:Stk17b APN 1 53,805,074 (GRCm39) splice site probably benign
IGL01914:Stk17b APN 1 53,800,226 (GRCm39) missense probably damaging 0.98
IGL02236:Stk17b APN 1 53,803,247 (GRCm39) missense probably damaging 1.00
IGL02827:Stk17b APN 1 53,815,701 (GRCm39) missense probably benign 0.03
R0013:Stk17b UTSW 1 53,803,291 (GRCm39) missense probably benign 0.36
R0545:Stk17b UTSW 1 53,801,742 (GRCm39) splice site probably benign
R0831:Stk17b UTSW 1 53,796,651 (GRCm39) missense probably damaging 1.00
R1035:Stk17b UTSW 1 53,801,758 (GRCm39) missense probably benign 0.22
R1375:Stk17b UTSW 1 53,805,106 (GRCm39) missense possibly damaging 0.83
R1576:Stk17b UTSW 1 53,796,749 (GRCm39) missense probably damaging 1.00
R1809:Stk17b UTSW 1 53,805,140 (GRCm39) missense possibly damaging 0.80
R1988:Stk17b UTSW 1 53,800,241 (GRCm39) missense probably damaging 1.00
R2033:Stk17b UTSW 1 53,800,235 (GRCm39) missense probably damaging 1.00
R2105:Stk17b UTSW 1 53,815,764 (GRCm39) missense probably benign 0.01
R2255:Stk17b UTSW 1 53,815,731 (GRCm39) missense probably benign 0.00
R4395:Stk17b UTSW 1 53,803,274 (GRCm39) missense probably damaging 0.98
R4521:Stk17b UTSW 1 53,803,197 (GRCm39) missense probably damaging 1.00
R4777:Stk17b UTSW 1 53,810,867 (GRCm39) missense probably damaging 1.00
R4871:Stk17b UTSW 1 53,796,693 (GRCm39) missense probably benign 0.14
R4892:Stk17b UTSW 1 53,810,770 (GRCm39) missense probably damaging 0.99
R4999:Stk17b UTSW 1 53,800,306 (GRCm39) splice site probably null
R5122:Stk17b UTSW 1 53,815,717 (GRCm39) missense probably damaging 1.00
R5621:Stk17b UTSW 1 53,810,943 (GRCm39) nonsense probably null
R6636:Stk17b UTSW 1 53,800,247 (GRCm39) missense probably damaging 1.00
R7283:Stk17b UTSW 1 53,796,674 (GRCm39) missense probably benign
R7322:Stk17b UTSW 1 53,805,104 (GRCm39) missense probably benign 0.16
R7671:Stk17b UTSW 1 53,805,159 (GRCm39) missense probably damaging 0.99
R8984:Stk17b UTSW 1 53,796,784 (GRCm39) missense probably benign 0.05
R9476:Stk17b UTSW 1 53,796,898 (GRCm39) missense probably damaging 1.00
R9510:Stk17b UTSW 1 53,796,898 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGAATCTCGCAACAGTTTCCAAAC -3'
(R):5'- AACTTTGCCAGACTTGTGGAC -3'

Sequencing Primer
(F):5'- AGCCATAAGTGACATTTTGGGTAG -3'
(R):5'- GCCAGACTTGTGGACTATTAATTG -3'
Posted On 2018-11-06