Incidental Mutation 'R6924:Gpr161'
ID539767
Institutional Source Beutler Lab
Gene Symbol Gpr161
Ensembl Gene ENSMUSG00000040836
Gene NameG protein-coupled receptor 161
SynonymsLOC240888, vl
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6924 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location165295789-165326745 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 165321619 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 519 (R519L)
Ref Sequence ENSEMBL: ENSMUSP00000136621 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111450] [ENSMUST00000178700]
Predicted Effect possibly damaging
Transcript: ENSMUST00000111450
AA Change: R502L

PolyPhen 2 Score 0.835 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000107077
Gene: ENSMUSG00000040836
AA Change: R502L

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 48 261 1.1e-6 PFAM
Pfam:7tm_1 57 337 3e-47 PFAM
low complexity region 476 489 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000178700
AA Change: R519L

PolyPhen 2 Score 0.835 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000136621
Gene: ENSMUSG00000040836
AA Change: R519L

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 63 273 1.5e-7 PFAM
Pfam:7tm_1 72 352 9.2e-48 PFAM
low complexity region 491 504 N/A INTRINSIC
Meta Mutation Damage Score 0.0718 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.8%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Upon ligand binding, G protein-coupled receptors, such as GPR161, activate cytoplasmic G proteins (see GNAS, MIM 139320), allowing the receptors to transduce extracellular signals across the plasma membrane into the cell. Phosphorylation of the receptor attenuates signaling (Matteson et al., 2008 [PubMed 18250320]).[supplied by OMIM, Aug 2008]
PHENOTYPE: Mice homozygous for a null mutation display complete embryonic lethality during organogenesis, extensive craniofacial abnormalities, ventralization of the neural tube with expansion of the floor plate, absence of limb development, and caudal spina bifida. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700009N14Rik A C 4: 39,450,884 H30P probably damaging Het
Abhd6 A T 14: 8,049,850 H213L possibly damaging Het
Adam22 T A 5: 8,367,322 N40I possibly damaging Het
Ankrd42 A G 7: 92,582,016 probably benign Het
Arhgap40 C T 2: 158,527,146 R63C probably benign Het
Atf7ip T G 6: 136,559,757 probably null Het
Atg7 T C 6: 114,709,211 probably null Het
Car6 A C 4: 150,189,256 probably null Het
Carmil1 A T 13: 24,075,684 C302* probably null Het
Ccdc117 A T 11: 5,534,255 M195K probably benign Het
Cep95 T C 11: 106,811,197 M383T probably damaging Het
Col20a1 A G 2: 180,996,850 E419G probably damaging Het
Cyp2d9 C G 15: 82,455,212 R272G probably damaging Het
Dhx57 A T 17: 80,238,815 M1380K possibly damaging Het
Dnah14 A G 1: 181,627,952 S881G probably benign Het
Fam126a T C 5: 23,986,135 probably null Het
Fcgbp T A 7: 28,093,823 I1084N probably benign Het
Fgf17 A T 14: 70,641,541 C21* probably null Het
Gemin4 A G 11: 76,212,336 L533P probably damaging Het
Gkn3 T C 6: 87,388,802 R12G probably benign Het
Grin2a A G 16: 9,663,228 V535A possibly damaging Het
Gys1 G A 7: 45,443,635 probably null Het
Hfm1 C T 5: 106,850,410 probably null Het
Hmcn2 T A 2: 31,350,505 probably null Het
Hnrnpul2 T C 19: 8,831,509 Y738H unknown Het
Igsf23 A G 7: 19,941,759 S141P possibly damaging Het
Lamc3 A C 2: 31,938,069 M1423L probably benign Het
Lcmt2 T C 2: 121,140,003 T200A probably benign Het
Lgr4 T C 2: 110,012,439 V899A probably damaging Het
Macf1 T A 4: 123,527,352 R36S possibly damaging Het
Mrgprb8 A G 7: 48,389,123 K181E possibly damaging Het
Muc2 G A 7: 141,697,834 V786M possibly damaging Het
Nacc2 T C 2: 26,090,029 T132A probably damaging Het
Nsmce2 T A 15: 59,378,925 I15K probably damaging Het
Olfr726 A G 14: 50,083,850 I277T possibly damaging Het
Olfr9 T G 10: 128,990,091 Y60D probably damaging Het
Otoa A T 7: 121,131,501 probably null Het
Otogl A G 10: 107,808,641 I1248T probably damaging Het
Ppp1r17 T A 6: 56,026,022 D32E probably damaging Het
Relt A C 7: 100,847,261 V427G probably damaging Het
Ric1 T A 19: 29,569,388 V256D probably damaging Het
Samhd1 T C 2: 157,109,483 T445A probably benign Het
Sepsecs T C 5: 52,664,304 I189V probably benign Het
Shroom3 T A 5: 92,964,403 D1793E probably damaging Het
Sim1 C T 10: 50,908,539 T137I probably benign Het
Stk17b A T 1: 53,761,059 D253E possibly damaging Het
Stmnd1 T C 13: 46,299,493 V215A probably benign Het
Tcl1 A G 12: 105,218,756 L65P probably damaging Het
Tiam2 A C 17: 3,507,795 K1231N probably damaging Het
Tm9sf3 T C 19: 41,218,278 Y476C probably damaging Het
Trim63 T C 4: 134,321,261 S194P probably damaging Het
Ugt1a10 T A 1: 88,055,657 I59N probably damaging Het
Vmn2r65 A G 7: 84,963,990 F7S probably benign Het
Zfp775 T A 6: 48,619,655 H154Q probably damaging Het
Zfp804b C T 5: 6,769,902 V1018I probably benign Het
Other mutations in Gpr161
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00595:Gpr161 APN 1 165318803 missense probably benign
IGL01090:Gpr161 APN 1 165306580 missense probably damaging 1.00
IGL01151:Gpr161 APN 1 165321509 missense probably damaging 1.00
IGL01763:Gpr161 APN 1 165317251 missense probably benign 0.09
IGL03206:Gpr161 APN 1 165321649 missense probably damaging 1.00
IGL03279:Gpr161 APN 1 165310529 missense probably damaging 1.00
IGL03378:Gpr161 APN 1 165310508 missense probably damaging 0.99
IGL03147:Gpr161 UTSW 1 165317308 missense probably benign 0.30
R0367:Gpr161 UTSW 1 165317236 splice site probably benign
R1827:Gpr161 UTSW 1 165306567 missense possibly damaging 0.94
R1970:Gpr161 UTSW 1 165306358 missense probably damaging 0.97
R1991:Gpr161 UTSW 1 165306563 missense probably damaging 0.98
R2425:Gpr161 UTSW 1 165310623 missense possibly damaging 0.83
R4805:Gpr161 UTSW 1 165306460 missense probably damaging 1.00
R5416:Gpr161 UTSW 1 165321461 missense probably benign 0.00
R5546:Gpr161 UTSW 1 165306413 missense possibly damaging 0.88
R5547:Gpr161 UTSW 1 165306413 missense possibly damaging 0.88
R5824:Gpr161 UTSW 1 165310991 missense possibly damaging 0.94
R6152:Gpr161 UTSW 1 165310295 missense possibly damaging 0.58
R6658:Gpr161 UTSW 1 165306567 missense possibly damaging 0.50
R7128:Gpr161 UTSW 1 165310457 missense possibly damaging 0.92
R7216:Gpr161 UTSW 1 165306546 missense probably benign 0.22
R7540:Gpr161 UTSW 1 165318835 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTCTGGAGTAGCAAGCCAG -3'
(R):5'- CCTCTCTGAGTGGTGACATG -3'

Sequencing Primer
(F):5'- AGCAGAGACCATATCCCTTTTCG -3'
(R):5'- CATGTTCCAGGGTCTTGGCAC -3'
Posted On2018-11-06