Incidental Mutation 'R6924:Dnah14'
ID 539768
Institutional Source Beutler Lab
Gene Symbol Dnah14
Ensembl Gene ENSMUSG00000047369
Gene Name dynein, axonemal, heavy chain 14
Synonyms A230079K17Rik, Dnahc14, Gm980, LOC381311
MMRRC Submission 045042-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.080) question?
Stock # R6924 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 181404158-181642306 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 181455517 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Glycine at position 881 (S881G)
Ref Sequence ENSEMBL: ENSMUSP00000146843 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000208001]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000208001
AA Change: S881G

PolyPhen 2 Score 0.039 (Sensitivity: 0.94; Specificity: 0.83)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.8%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Dyneins are microtubule-associated motor protein complexes composed of several heavy, light, and intermediate chains. Two major classes of dyneins, axonemal and cytoplasmic, have been identified. DNAH14 is an axonemal dynein heavy chain (DHC) (Vaughan et al., 1996 [PubMed 8812413]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700009N14Rik A C 4: 39,450,884 (GRCm39) H30P probably damaging Het
Abhd6 A T 14: 8,049,850 (GRCm38) H213L possibly damaging Het
Adam22 T A 5: 8,417,322 (GRCm39) N40I possibly damaging Het
Ankrd42 A G 7: 92,231,224 (GRCm39) probably benign Het
Arhgap40 C T 2: 158,369,066 (GRCm39) R63C probably benign Het
Atf7ip T G 6: 136,536,755 (GRCm39) probably null Het
Atg7 T C 6: 114,686,172 (GRCm39) probably null Het
Car6 A C 4: 150,273,713 (GRCm39) probably null Het
Carmil1 A T 13: 24,259,667 (GRCm39) C302* probably null Het
Ccdc117 A T 11: 5,484,255 (GRCm39) M195K probably benign Het
Cep95 T C 11: 106,702,023 (GRCm39) M383T probably damaging Het
Col20a1 A G 2: 180,638,643 (GRCm39) E419G probably damaging Het
Cyp2d9 C G 15: 82,339,413 (GRCm39) R272G probably damaging Het
Dhx57 A T 17: 80,546,244 (GRCm39) M1380K possibly damaging Het
Fcgbp T A 7: 27,793,248 (GRCm39) I1084N probably benign Het
Fgf17 A T 14: 70,878,981 (GRCm39) C21* probably null Het
Gemin4 A G 11: 76,103,162 (GRCm39) L533P probably damaging Het
Gkn3 T C 6: 87,365,784 (GRCm39) R12G probably benign Het
Gpr161 G T 1: 165,149,188 (GRCm39) R519L possibly damaging Het
Grin2a A G 16: 9,481,092 (GRCm39) V535A possibly damaging Het
Gys1 G A 7: 45,093,059 (GRCm39) probably null Het
Hfm1 C T 5: 106,998,276 (GRCm39) probably null Het
Hmcn2 T A 2: 31,240,517 (GRCm39) probably null Het
Hnrnpul2 T C 19: 8,808,873 (GRCm39) Y738H unknown Het
Hycc1 T C 5: 24,191,133 (GRCm39) probably null Het
Igsf23 A G 7: 19,675,684 (GRCm39) S141P possibly damaging Het
Lamc3 A C 2: 31,828,081 (GRCm39) M1423L probably benign Het
Lcmt2 T C 2: 120,970,484 (GRCm39) T200A probably benign Het
Lgr4 T C 2: 109,842,784 (GRCm39) V899A probably damaging Het
Macf1 T A 4: 123,421,145 (GRCm39) R36S possibly damaging Het
Mrgprb8 A G 7: 48,038,871 (GRCm39) K181E possibly damaging Het
Muc2 G A 7: 141,284,077 (GRCm39) V786M possibly damaging Het
Nacc2 T C 2: 25,980,041 (GRCm39) T132A probably damaging Het
Nsmce2 T A 15: 59,250,774 (GRCm39) I15K probably damaging Het
Or10p22 T G 10: 128,825,960 (GRCm39) Y60D probably damaging Het
Or4k15c A G 14: 50,321,307 (GRCm39) I277T possibly damaging Het
Otoa A T 7: 120,730,724 (GRCm39) probably null Het
Otogl A G 10: 107,644,502 (GRCm39) I1248T probably damaging Het
Ppp1r17 T A 6: 56,003,007 (GRCm39) D32E probably damaging Het
Relt A C 7: 100,496,468 (GRCm39) V427G probably damaging Het
Ric1 T A 19: 29,546,788 (GRCm39) V256D probably damaging Het
Samhd1 T C 2: 156,951,403 (GRCm39) T445A probably benign Het
Sepsecs T C 5: 52,821,646 (GRCm39) I189V probably benign Het
Shroom3 T A 5: 93,112,262 (GRCm39) D1793E probably damaging Het
Sim1 C T 10: 50,784,635 (GRCm39) T137I probably benign Het
Stk17b A T 1: 53,800,218 (GRCm39) D253E possibly damaging Het
Stmnd1 T C 13: 46,452,969 (GRCm39) V215A probably benign Het
Tcl1 A G 12: 105,185,015 (GRCm39) L65P probably damaging Het
Tiam2 A C 17: 3,558,070 (GRCm39) K1231N probably damaging Het
Tm9sf3 T C 19: 41,206,717 (GRCm39) Y476C probably damaging Het
Trim63 T C 4: 134,048,572 (GRCm39) S194P probably damaging Het
Ugt1a10 T A 1: 87,983,379 (GRCm39) I59N probably damaging Het
Vmn2r65 A G 7: 84,613,198 (GRCm39) F7S probably benign Het
Zfp775 T A 6: 48,596,589 (GRCm39) H154Q probably damaging Het
Zfp804b C T 5: 6,819,902 (GRCm39) V1018I probably benign Het
Other mutations in Dnah14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01086:Dnah14 APN 1 181,579,611 (GRCm39) missense probably benign 0.17
IGL01764:Dnah14 APN 1 181,572,342 (GRCm39) missense probably benign 0.00
IGL03218:Dnah14 APN 1 181,582,834 (GRCm39) missense probably benign 0.02
IGL03290:Dnah14 APN 1 181,591,543 (GRCm39) splice site probably benign
IGL03384:Dnah14 APN 1 181,573,514 (GRCm39) missense probably benign 0.03
R0009:Dnah14 UTSW 1 181,596,972 (GRCm39) splice site probably benign
R0125:Dnah14 UTSW 1 181,579,628 (GRCm39) missense probably damaging 0.99
R0579:Dnah14 UTSW 1 181,572,312 (GRCm39) missense possibly damaging 0.72
R0973:Dnah14 UTSW 1 181,579,710 (GRCm39) missense probably damaging 1.00
R0973:Dnah14 UTSW 1 181,579,710 (GRCm39) missense probably damaging 1.00
R0974:Dnah14 UTSW 1 181,579,710 (GRCm39) missense probably damaging 1.00
R1609:Dnah14 UTSW 1 181,577,742 (GRCm39) missense probably damaging 0.97
R1860:Dnah14 UTSW 1 181,591,525 (GRCm39) missense probably damaging 1.00
R2050:Dnah14 UTSW 1 181,580,127 (GRCm39) missense probably damaging 1.00
R2974:Dnah14 UTSW 1 181,582,806 (GRCm39) critical splice acceptor site probably null
R4715:Dnah14 UTSW 1 181,584,788 (GRCm39) missense probably damaging 1.00
R5076:Dnah14 UTSW 1 181,584,799 (GRCm39) missense probably benign 0.01
R5424:Dnah14 UTSW 1 181,590,875 (GRCm39) missense possibly damaging 0.95
R5808:Dnah14 UTSW 1 181,568,724 (GRCm39) missense possibly damaging 0.72
R5997:Dnah14 UTSW 1 181,597,670 (GRCm39) missense probably benign 0.00
R6052:Dnah14 UTSW 1 181,494,052 (GRCm39) missense possibly damaging 0.50
R6061:Dnah14 UTSW 1 181,536,616 (GRCm39) missense probably damaging 1.00
R6089:Dnah14 UTSW 1 181,577,719 (GRCm39) missense probably damaging 1.00
R6092:Dnah14 UTSW 1 181,449,398 (GRCm39) missense probably benign 0.13
R6145:Dnah14 UTSW 1 181,493,982 (GRCm39) missense probably benign 0.00
R6163:Dnah14 UTSW 1 181,493,926 (GRCm39) missense probably benign 0.33
R6246:Dnah14 UTSW 1 181,508,453 (GRCm39) missense probably benign 0.00
R6302:Dnah14 UTSW 1 181,428,771 (GRCm39) missense possibly damaging 0.96
R6306:Dnah14 UTSW 1 181,412,589 (GRCm39) frame shift probably null
R6326:Dnah14 UTSW 1 181,611,121 (GRCm39) missense probably damaging 1.00
R6348:Dnah14 UTSW 1 181,454,285 (GRCm39) missense possibly damaging 0.83
R6367:Dnah14 UTSW 1 181,582,951 (GRCm39) splice site probably null
R6376:Dnah14 UTSW 1 181,433,459 (GRCm39) missense possibly damaging 0.79
R6389:Dnah14 UTSW 1 181,478,767 (GRCm39) critical splice donor site probably null
R6433:Dnah14 UTSW 1 181,479,222 (GRCm39) missense probably damaging 0.99
R6454:Dnah14 UTSW 1 181,611,270 (GRCm39) missense probably damaging 1.00
R6476:Dnah14 UTSW 1 181,572,333 (GRCm39) missense probably benign 0.26
R6523:Dnah14 UTSW 1 181,471,186 (GRCm39) missense probably benign 0.00
R6529:Dnah14 UTSW 1 181,494,034 (GRCm39) missense probably damaging 0.98
R6538:Dnah14 UTSW 1 181,412,550 (GRCm39) missense unknown
R6546:Dnah14 UTSW 1 181,566,552 (GRCm39) missense probably damaging 1.00
R6752:Dnah14 UTSW 1 181,421,017 (GRCm39) missense probably benign 0.07
R6762:Dnah14 UTSW 1 181,584,824 (GRCm39) missense probably damaging 1.00
R6786:Dnah14 UTSW 1 181,468,970 (GRCm39) missense probably benign 0.21
R6849:Dnah14 UTSW 1 181,636,510 (GRCm39) missense probably benign 0.00
R6877:Dnah14 UTSW 1 181,455,997 (GRCm39) missense possibly damaging 0.82
R6912:Dnah14 UTSW 1 181,577,748 (GRCm39) missense possibly damaging 0.83
R6919:Dnah14 UTSW 1 181,412,631 (GRCm39) missense probably benign 0.04
R6957:Dnah14 UTSW 1 181,612,740 (GRCm39) missense possibly damaging 0.92
R6980:Dnah14 UTSW 1 181,475,795 (GRCm39) missense probably benign 0.00
R7018:Dnah14 UTSW 1 181,454,509 (GRCm39) missense possibly damaging 0.55
R7046:Dnah14 UTSW 1 181,450,568 (GRCm39) missense probably benign 0.01
R7058:Dnah14 UTSW 1 181,525,614 (GRCm39) missense probably benign 0.00
R7068:Dnah14 UTSW 1 181,597,355 (GRCm39) missense probably benign 0.35
R7115:Dnah14 UTSW 1 181,547,710 (GRCm39) missense probably damaging 1.00
R7130:Dnah14 UTSW 1 181,573,523 (GRCm39) nonsense probably null
R7165:Dnah14 UTSW 1 181,532,100 (GRCm39) missense probably benign 0.00
R7169:Dnah14 UTSW 1 181,529,930 (GRCm39) missense probably benign 0.00
R7184:Dnah14 UTSW 1 181,532,094 (GRCm39) nonsense probably null
R7232:Dnah14 UTSW 1 181,584,928 (GRCm39) missense probably damaging 1.00
R7260:Dnah14 UTSW 1 181,534,309 (GRCm39) missense probably damaging 0.99
R7276:Dnah14 UTSW 1 181,513,372 (GRCm39) missense probably benign 0.41
R7290:Dnah14 UTSW 1 181,455,739 (GRCm39) missense probably benign 0.20
R7314:Dnah14 UTSW 1 181,612,819 (GRCm39) splice site probably null
R7326:Dnah14 UTSW 1 181,425,968 (GRCm39) missense probably benign 0.02
R7336:Dnah14 UTSW 1 181,625,299 (GRCm39) missense probably damaging 0.96
R7363:Dnah14 UTSW 1 181,518,089 (GRCm39) splice site probably null
R7371:Dnah14 UTSW 1 181,454,450 (GRCm39) missense probably benign 0.05
R7376:Dnah14 UTSW 1 181,590,967 (GRCm39) missense probably benign 0.03
R7418:Dnah14 UTSW 1 181,444,307 (GRCm39) missense possibly damaging 0.92
R7473:Dnah14 UTSW 1 181,579,704 (GRCm39) missense probably damaging 0.99
R7514:Dnah14 UTSW 1 181,455,632 (GRCm39) missense probably damaging 0.96
R7555:Dnah14 UTSW 1 181,597,619 (GRCm39) missense probably benign 0.26
R7641:Dnah14 UTSW 1 181,535,098 (GRCm39) missense probably benign 0.01
R7663:Dnah14 UTSW 1 181,579,720 (GRCm39) splice site probably null
R7674:Dnah14 UTSW 1 181,535,098 (GRCm39) missense probably benign 0.01
R7680:Dnah14 UTSW 1 181,513,365 (GRCm39) missense probably benign 0.15
R7709:Dnah14 UTSW 1 181,530,049 (GRCm39) critical splice donor site probably null
R7842:Dnah14 UTSW 1 181,455,463 (GRCm39) missense probably damaging 0.99
R7861:Dnah14 UTSW 1 181,444,324 (GRCm39) missense probably damaging 1.00
R7988:Dnah14 UTSW 1 181,611,139 (GRCm39) missense probably damaging 0.97
R8016:Dnah14 UTSW 1 181,475,876 (GRCm39) missense probably benign 0.05
R8042:Dnah14 UTSW 1 181,471,196 (GRCm39) critical splice donor site probably null
R8071:Dnah14 UTSW 1 181,443,459 (GRCm39) missense possibly damaging 0.84
R8086:Dnah14 UTSW 1 181,593,797 (GRCm39) missense probably damaging 1.00
R8095:Dnah14 UTSW 1 181,633,597 (GRCm39) nonsense probably null
R8139:Dnah14 UTSW 1 181,582,853 (GRCm39) missense probably damaging 1.00
R8176:Dnah14 UTSW 1 181,484,598 (GRCm39) missense probably damaging 0.96
R8193:Dnah14 UTSW 1 181,515,770 (GRCm39) missense probably damaging 1.00
R8197:Dnah14 UTSW 1 181,517,666 (GRCm39) missense possibly damaging 0.94
R8209:Dnah14 UTSW 1 181,623,110 (GRCm39) missense possibly damaging 0.69
R8226:Dnah14 UTSW 1 181,623,110 (GRCm39) missense possibly damaging 0.69
R8251:Dnah14 UTSW 1 181,492,430 (GRCm39) missense probably damaging 1.00
R8264:Dnah14 UTSW 1 181,572,357 (GRCm39) missense probably damaging 0.99
R8284:Dnah14 UTSW 1 181,601,376 (GRCm39) missense probably benign 0.03
R8289:Dnah14 UTSW 1 181,543,780 (GRCm39) nonsense probably null
R8323:Dnah14 UTSW 1 181,532,109 (GRCm39) missense probably benign 0.01
R8442:Dnah14 UTSW 1 181,568,849 (GRCm39) missense probably damaging 0.97
R8458:Dnah14 UTSW 1 181,633,577 (GRCm39) missense
R8507:Dnah14 UTSW 1 181,468,979 (GRCm39) missense probably benign 0.02
R8509:Dnah14 UTSW 1 181,642,220 (GRCm39) missense
R8520:Dnah14 UTSW 1 181,481,203 (GRCm39) missense probably damaging 1.00
R8530:Dnah14 UTSW 1 181,492,511 (GRCm39) missense probably damaging 1.00
R8703:Dnah14 UTSW 1 181,493,576 (GRCm39) nonsense probably null
R8710:Dnah14 UTSW 1 181,517,876 (GRCm39) missense probably benign 0.04
R8752:Dnah14 UTSW 1 181,455,581 (GRCm39) missense probably benign 0.00
R8792:Dnah14 UTSW 1 181,642,189 (GRCm39) missense
R8797:Dnah14 UTSW 1 181,465,412 (GRCm39) missense probably benign 0.19
R8821:Dnah14 UTSW 1 181,619,569 (GRCm39) nonsense probably null
R8834:Dnah14 UTSW 1 181,444,315 (GRCm39) missense possibly damaging 0.83
R8913:Dnah14 UTSW 1 181,553,063 (GRCm39) missense probably benign 0.01
R8925:Dnah14 UTSW 1 181,508,321 (GRCm39) missense probably damaging 1.00
R8927:Dnah14 UTSW 1 181,508,321 (GRCm39) missense probably damaging 1.00
R8934:Dnah14 UTSW 1 181,450,288 (GRCm39) missense possibly damaging 0.84
R9090:Dnah14 UTSW 1 181,597,325 (GRCm39) missense probably benign 0.33
R9169:Dnah14 UTSW 1 181,433,381 (GRCm39) missense probably benign 0.06
R9199:Dnah14 UTSW 1 181,478,566 (GRCm39) missense possibly damaging 0.50
R9212:Dnah14 UTSW 1 181,628,852 (GRCm39) missense possibly damaging 0.95
R9213:Dnah14 UTSW 1 181,444,205 (GRCm39) critical splice donor site probably null
R9271:Dnah14 UTSW 1 181,597,325 (GRCm39) missense probably benign 0.33
R9282:Dnah14 UTSW 1 181,642,077 (GRCm39) missense
R9350:Dnah14 UTSW 1 181,562,369 (GRCm39) missense possibly damaging 0.79
R9358:Dnah14 UTSW 1 181,536,598 (GRCm39) missense probably benign 0.01
R9436:Dnah14 UTSW 1 181,508,348 (GRCm39) missense probably damaging 1.00
R9484:Dnah14 UTSW 1 181,625,311 (GRCm39) missense probably benign 0.01
R9484:Dnah14 UTSW 1 181,517,773 (GRCm39) missense probably benign 0.45
R9486:Dnah14 UTSW 1 181,508,494 (GRCm39) missense possibly damaging 0.68
R9546:Dnah14 UTSW 1 181,420,992 (GRCm39) critical splice acceptor site probably null
R9547:Dnah14 UTSW 1 181,420,992 (GRCm39) critical splice acceptor site probably null
R9578:Dnah14 UTSW 1 181,502,007 (GRCm39) missense probably benign 0.16
R9654:Dnah14 UTSW 1 181,593,904 (GRCm39) missense probably benign 0.01
R9681:Dnah14 UTSW 1 181,562,414 (GRCm39) missense possibly damaging 0.91
R9683:Dnah14 UTSW 1 181,426,509 (GRCm39) missense probably benign 0.01
R9687:Dnah14 UTSW 1 181,425,978 (GRCm39) missense probably benign 0.01
R9718:Dnah14 UTSW 1 181,450,544 (GRCm39) missense probably benign 0.08
R9751:Dnah14 UTSW 1 181,619,610 (GRCm39) missense probably damaging 1.00
R9757:Dnah14 UTSW 1 181,513,349 (GRCm39) missense probably benign 0.03
RF007:Dnah14 UTSW 1 181,513,374 (GRCm39) missense probably benign 0.00
RF012:Dnah14 UTSW 1 181,455,463 (GRCm39) missense probably damaging 0.99
Z1176:Dnah14 UTSW 1 181,584,916 (GRCm39) missense possibly damaging 0.83
Z1177:Dnah14 UTSW 1 181,517,885 (GRCm39) missense probably benign 0.03
Z1177:Dnah14 UTSW 1 181,593,869 (GRCm39) missense probably damaging 1.00
Z1177:Dnah14 UTSW 1 181,590,899 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAGGGCAGCAAAGTTCTTC -3'
(R):5'- AGTACAGTTCCTCCATTCCCAG -3'

Sequencing Primer
(F):5'- GGGCAGCAAAGTTCTTCAACAAC -3'
(R):5'- AGTTCCTCCATTCCCAGAAATATTTC -3'
Posted On 2018-11-06