Incidental Mutation 'R6924:Cyp2d9'
ID539812
Institutional Source Beutler Lab
Gene Symbol Cyp2d9
Ensembl Gene ENSMUSG00000068086
Gene Namecytochrome P450, family 2, subfamily d, polypeptide 9
SynonymsCyp2d, testosterone 16alpha-hydroxylase, P450-2D
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.096) question?
Stock #R6924 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location82433437-82456845 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 82455212 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 272 (R272G)
Ref Sequence ENSEMBL: ENSMUSP00000155496 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089129] [ENSMUST00000229313] [ENSMUST00000229473] [ENSMUST00000229793] [ENSMUST00000230000] [ENSMUST00000230024] [ENSMUST00000230191] [ENSMUST00000231136]
Predicted Effect probably benign
Transcript: ENSMUST00000089129
AA Change: R272G

PolyPhen 2 Score 0.388 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000086530
Gene: ENSMUSG00000068086
AA Change: R272G

DomainStartEndE-ValueType
Pfam:p450 37 497 1.7e-142 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000229313
Predicted Effect probably benign
Transcript: ENSMUST00000229473
Predicted Effect probably benign
Transcript: ENSMUST00000229793
Predicted Effect possibly damaging
Transcript: ENSMUST00000230000
AA Change: R149G

PolyPhen 2 Score 0.781 (Sensitivity: 0.85; Specificity: 0.93)
Predicted Effect possibly damaging
Transcript: ENSMUST00000230024
AA Change: R61G

PolyPhen 2 Score 0.639 (Sensitivity: 0.87; Specificity: 0.91)
Predicted Effect probably damaging
Transcript: ENSMUST00000230191
AA Change: R272G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Predicted Effect possibly damaging
Transcript: ENSMUST00000231136
AA Change: R242G

PolyPhen 2 Score 0.951 (Sensitivity: 0.79; Specificity: 0.95)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.8%
Validation Efficiency 98% (54/55)
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700009N14Rik A C 4: 39,450,884 H30P probably damaging Het
Abhd6 A T 14: 8,049,850 H213L possibly damaging Het
Adam22 T A 5: 8,367,322 N40I possibly damaging Het
Ankrd42 A G 7: 92,582,016 probably benign Het
Arhgap40 C T 2: 158,527,146 R63C probably benign Het
Atf7ip T G 6: 136,559,757 probably null Het
Atg7 T C 6: 114,709,211 probably null Het
Car6 A C 4: 150,189,256 probably null Het
Carmil1 A T 13: 24,075,684 C302* probably null Het
Ccdc117 A T 11: 5,534,255 M195K probably benign Het
Cep95 T C 11: 106,811,197 M383T probably damaging Het
Col20a1 A G 2: 180,996,850 E419G probably damaging Het
Dhx57 A T 17: 80,238,815 M1380K possibly damaging Het
Dnah14 A G 1: 181,627,952 S881G probably benign Het
Fam126a T C 5: 23,986,135 probably null Het
Fcgbp T A 7: 28,093,823 I1084N probably benign Het
Fgf17 A T 14: 70,641,541 C21* probably null Het
Gemin4 A G 11: 76,212,336 L533P probably damaging Het
Gkn3 T C 6: 87,388,802 R12G probably benign Het
Gpr161 G T 1: 165,321,619 R519L possibly damaging Het
Grin2a A G 16: 9,663,228 V535A possibly damaging Het
Gys1 G A 7: 45,443,635 probably null Het
Hfm1 C T 5: 106,850,410 probably null Het
Hmcn2 T A 2: 31,350,505 probably null Het
Hnrnpul2 T C 19: 8,831,509 Y738H unknown Het
Igsf23 A G 7: 19,941,759 S141P possibly damaging Het
Lamc3 A C 2: 31,938,069 M1423L probably benign Het
Lcmt2 T C 2: 121,140,003 T200A probably benign Het
Lgr4 T C 2: 110,012,439 V899A probably damaging Het
Macf1 T A 4: 123,527,352 R36S possibly damaging Het
Mrgprb8 A G 7: 48,389,123 K181E possibly damaging Het
Muc2 G A 7: 141,697,834 V786M possibly damaging Het
Nacc2 T C 2: 26,090,029 T132A probably damaging Het
Nsmce2 T A 15: 59,378,925 I15K probably damaging Het
Olfr726 A G 14: 50,083,850 I277T possibly damaging Het
Olfr9 T G 10: 128,990,091 Y60D probably damaging Het
Otoa A T 7: 121,131,501 probably null Het
Otogl A G 10: 107,808,641 I1248T probably damaging Het
Ppp1r17 T A 6: 56,026,022 D32E probably damaging Het
Relt A C 7: 100,847,261 V427G probably damaging Het
Ric1 T A 19: 29,569,388 V256D probably damaging Het
Samhd1 T C 2: 157,109,483 T445A probably benign Het
Sepsecs T C 5: 52,664,304 I189V probably benign Het
Shroom3 T A 5: 92,964,403 D1793E probably damaging Het
Sim1 C T 10: 50,908,539 T137I probably benign Het
Stk17b A T 1: 53,761,059 D253E possibly damaging Het
Stmnd1 T C 13: 46,299,493 V215A probably benign Het
Tcl1 A G 12: 105,218,756 L65P probably damaging Het
Tiam2 A C 17: 3,507,795 K1231N probably damaging Het
Tm9sf3 T C 19: 41,218,278 Y476C probably damaging Het
Trim63 T C 4: 134,321,261 S194P probably damaging Het
Ugt1a10 T A 1: 88,055,657 I59N probably damaging Het
Vmn2r65 A G 7: 84,963,990 F7S probably benign Het
Zfp775 T A 6: 48,619,655 H154Q probably damaging Het
Zfp804b C T 5: 6,769,902 V1018I probably benign Het
Other mutations in Cyp2d9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00516:Cyp2d9 APN 15 82455094 missense probably benign 0.05
IGL00587:Cyp2d9 APN 15 82455143 missense possibly damaging 0.89
IGL00815:Cyp2d9 APN 15 82456375 missense possibly damaging 0.94
IGL03023:Cyp2d9 APN 15 82455518 missense probably damaging 0.99
IGL03410:Cyp2d9 APN 15 82456699 missense probably benign 0.00
R0417:Cyp2d9 UTSW 15 82455951 missense probably damaging 1.00
R0627:Cyp2d9 UTSW 15 82455790 missense probably damaging 1.00
R1326:Cyp2d9 UTSW 15 82455156 missense possibly damaging 0.50
R1501:Cyp2d9 UTSW 15 82454324 nonsense probably null
R1893:Cyp2d9 UTSW 15 82452606 missense probably damaging 0.97
R2496:Cyp2d9 UTSW 15 82452479 missense probably damaging 1.00
R2519:Cyp2d9 UTSW 15 82454518 splice site probably null
R3155:Cyp2d9 UTSW 15 82452642 critical splice donor site probably null
R4691:Cyp2d9 UTSW 15 82455832 missense probably damaging 1.00
R4727:Cyp2d9 UTSW 15 82454401 start codon destroyed probably null 0.99
R4770:Cyp2d9 UTSW 15 82452573 missense probably damaging 0.98
R5319:Cyp2d9 UTSW 15 82454055 missense probably damaging 1.00
R5486:Cyp2d9 UTSW 15 82452578 missense probably damaging 0.96
R5516:Cyp2d9 UTSW 15 82454327 missense probably null 1.00
R5646:Cyp2d9 UTSW 15 82452464 missense probably benign 0.01
R5898:Cyp2d9 UTSW 15 82455524 missense probably benign 0.02
R6193:Cyp2d9 UTSW 15 82452527 missense probably benign 0.01
R6288:Cyp2d9 UTSW 15 82456415 missense probably damaging 1.00
R7524:Cyp2d9 UTSW 15 82455945 missense probably damaging 1.00
R7525:Cyp2d9 UTSW 15 82454092 missense possibly damaging 0.91
R7731:Cyp2d9 UTSW 15 82455432 critical splice acceptor site probably null
R7889:Cyp2d9 UTSW 15 82455826 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- GATTAACCTCTGAGACTTCCTATGTC -3'
(R):5'- TCAGGATTCCCTTTGGCCTG -3'

Sequencing Primer
(F):5'- GAGACTTCCTATGTCTCTCACAGG -3'
(R):5'- AGGAAGTCCCACATGGCCTC -3'
Posted On2018-11-06