Mutagenetix > Incidental Mutation

Incidental Mutation 'R6924:Grin2a'

539813

Institutional Source

Beutler Lab

Gene Symbol

Grin2a

Ensembl Gene

ENSMUSG00000059003

Gene Name

glutamate receptor, ionotropic, NMDA2A (epsilon 1)

Synonyms

NR2A, GluRepsilon1, NMDAR2A, GluN2A

MMRRC Submission

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.510) question?

Stock #

R6924 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

9567898-9995560 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 9663228 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 535 (V535A)

Ref Sequence

ENSEMBL: ENSMUSP00000142900 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000032331] [ENSMUST00000115835] [ENSMUST00000199708]

AlphaFold

P35436

Predicted Effect

possibly damaging
Transcript: ENSMUST00000032331
AA Change: V535A

PolyPhen 2 Score 0.712 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000032331
Gene: ENSMUSG00000059003
AA Change: V535A

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
Pfam:ANF_receptor	106	301	1.6e-10	PFAM
PBPe	431	798	1.68e-70	SMART
Lig_chan-Glu_bd	439	502	2.24e-22	SMART
transmembrane domain	818	837	N/A	INTRINSIC
Pfam:NMDAR2_C	839	1464	2.1e-230	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000115835
AA Change: V535A

PolyPhen 2 Score 0.712 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000111501
Gene: ENSMUSG00000059003
AA Change: V535A

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
Pfam:ANF_receptor	99	300	9.2e-11	PFAM
PBPe	431	798	1.68e-70	SMART
Lig_chan-Glu_bd	439	502	2.24e-22	SMART
transmembrane domain	818	837	N/A	INTRINSIC
Pfam:NMDAR2_C	839	1464	1.2e-266	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000199708
AA Change: V535A

PolyPhen 2 Score 0.712 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000142900
Gene: ENSMUSG00000059003
AA Change: V535A

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
Pfam:ANF_receptor	106	301	1.6e-10	PFAM
PBPe	431	798	1.68e-70	SMART
Lig_chan-Glu_bd	439	502	2.24e-22	SMART
transmembrane domain	818	837	N/A	INTRINSIC
Pfam:NMDAR2_C	839	1464	2.1e-230	PFAM

Meta Mutation Damage Score

0.8688

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.3%
20x: 97.8%

Validation Efficiency

98% (54/55)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the glutamate-gated ion channel protein family. The encoded protein is an N-methyl-D-aspartate (NMDA) receptor subunit. NMDA receptors are both ligand-gated and voltage-dependent, and are involved in long-term potentiation, an activity-dependent increase in the efficiency of synaptic transmission thought to underlie certain kinds of memory and learning. These receptors are permeable to calcium ions, and activation results in a calcium influx into post-synaptic cells, which results in the activation of several signaling cascades. Disruption of this gene is associated with focal epilepsy and speech disorder with or without mental retardation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2014]
PHENOTYPE: Homozygotes for targeted null mutations exhibit jumpiness, mildly impaired long-term potentiation and spatial learning, increased locomotor activity and metabolism of dopamine and serotonin, and loss of analgesic tolerance after repeated morphine doses. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700009N14Rik	A	C	4: 39,450,884	H30P	probably damaging	Het
Abhd6	A	T	14: 8,049,850	H213L	possibly damaging	Het
Adam22	T	A	5: 8,367,322	N40I	possibly damaging	Het
Ankrd42	A	G	7: 92,582,016		probably benign	Het
Arhgap40	C	T	2: 158,527,146	R63C	probably benign	Het
Atf7ip	T	G	6: 136,559,757		probably null	Het
Atg7	T	C	6: 114,709,211		probably null	Het
Car6	A	C	4: 150,189,256		probably null	Het
Carmil1	A	T	13: 24,075,684	C302*	probably null	Het
Ccdc117	A	T	11: 5,534,255	M195K	probably benign	Het
Cep95	T	C	11: 106,811,197	M383T	probably damaging	Het
Col20a1	A	G	2: 180,996,850	E419G	probably damaging	Het
Cyp2d9	C	G	15: 82,455,212	R272G	probably damaging	Het
Dhx57	A	T	17: 80,238,815	M1380K	possibly damaging	Het
Dnah14	A	G	1: 181,627,952	S881G	probably benign	Het
Fam126a	T	C	5: 23,986,135		probably null	Het
Fcgbp	T	A	7: 28,093,823	I1084N	probably benign	Het
Fgf17	A	T	14: 70,641,541	C21*	probably null	Het
Gemin4	A	G	11: 76,212,336	L533P	probably damaging	Het
Gkn3	T	C	6: 87,388,802	R12G	probably benign	Het
Gpr161	G	T	1: 165,321,619	R519L	possibly damaging	Het
Gys1	G	A	7: 45,443,635		probably null	Het
Hfm1	C	T	5: 106,850,410		probably null	Het
Hmcn2	T	A	2: 31,350,505		probably null	Het
Hnrnpul2	T	C	19: 8,831,509	Y738H	unknown	Het
Igsf23	A	G	7: 19,941,759	S141P	possibly damaging	Het
Lamc3	A	C	2: 31,938,069	M1423L	probably benign	Het
Lcmt2	T	C	2: 121,140,003	T200A	probably benign	Het
Lgr4	T	C	2: 110,012,439	V899A	probably damaging	Het
Macf1	T	A	4: 123,527,352	R36S	possibly damaging	Het
Mrgprb8	A	G	7: 48,389,123	K181E	possibly damaging	Het
Muc2	G	A	7: 141,697,834	V786M	possibly damaging	Het
Nacc2	T	C	2: 26,090,029	T132A	probably damaging	Het
Nsmce2	T	A	15: 59,378,925	I15K	probably damaging	Het
Olfr726	A	G	14: 50,083,850	I277T	possibly damaging	Het
Olfr9	T	G	10: 128,990,091	Y60D	probably damaging	Het
Otoa	A	T	7: 121,131,501		probably null	Het
Otogl	A	G	10: 107,808,641	I1248T	probably damaging	Het
Ppp1r17	T	A	6: 56,026,022	D32E	probably damaging	Het
Relt	A	C	7: 100,847,261	V427G	probably damaging	Het
Ric1	T	A	19: 29,569,388	V256D	probably damaging	Het
Samhd1	T	C	2: 157,109,483	T445A	probably benign	Het
Sepsecs	T	C	5: 52,664,304	I189V	probably benign	Het
Shroom3	T	A	5: 92,964,403	D1793E	probably damaging	Het
Sim1	C	T	10: 50,908,539	T137I	probably benign	Het
Stk17b	A	T	1: 53,761,059	D253E	possibly damaging	Het
Stmnd1	T	C	13: 46,299,493	V215A	probably benign	Het
Tcl1	A	G	12: 105,218,756	L65P	probably damaging	Het
Tiam2	A	C	17: 3,507,795	K1231N	probably damaging	Het
Tm9sf3	T	C	19: 41,218,278	Y476C	probably damaging	Het
Trim63	T	C	4: 134,321,261	S194P	probably damaging	Het
Ugt1a10	T	A	1: 88,055,657	I59N	probably damaging	Het
Vmn2r65	A	G	7: 84,963,990	F7S	probably benign	Het
Zfp775	T	A	6: 48,619,655	H154Q	probably damaging	Het
Zfp804b	C	T	5: 6,769,902	V1018I	probably benign	Het

Other mutations in Grin2a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01777:Grin2a	APN	16	9644130	missense	probably benign	0.29
IGL03288:Grin2a	APN	16	9669840	missense	possibly damaging	0.85
IGL02796:Grin2a	UTSW	16	9585108	missense	possibly damaging	0.72
PIT4402001:Grin2a	UTSW	16	9644199	missense	possibly damaging	0.77
PIT4494001:Grin2a	UTSW	16	9585096	missense	probably damaging	0.98
R0055:Grin2a	UTSW	16	9669807	missense	probably damaging	0.99
R0055:Grin2a	UTSW	16	9669807	missense	probably damaging	0.99
R0164:Grin2a	UTSW	16	9994821	critical splice donor site	probably null
R0164:Grin2a	UTSW	16	9994821	critical splice donor site	probably null
R0211:Grin2a	UTSW	16	9579173	missense	possibly damaging	0.86
R0390:Grin2a	UTSW	16	9579585	missense	possibly damaging	0.85
R0659:Grin2a	UTSW	16	9992472	missense	probably damaging	0.98
R0661:Grin2a	UTSW	16	9992472	missense	probably damaging	0.98
R0734:Grin2a	UTSW	16	9579611	missense	possibly damaging	0.71
R1524:Grin2a	UTSW	16	9663603	missense	possibly damaging	0.55
R1542:Grin2a	UTSW	16	9579203	missense	probably damaging	0.98
R1556:Grin2a	UTSW	16	9707715	missense	probably benign	0.18
R1605:Grin2a	UTSW	16	9663330	missense	possibly damaging	0.46
R1792:Grin2a	UTSW	16	9992395	missense	possibly damaging	0.53
R2024:Grin2a	UTSW	16	9644243	missense	possibly damaging	0.76
R2057:Grin2a	UTSW	16	9669744	missense	probably benign	0.14
R2344:Grin2a	UTSW	16	9663235	missense	probably benign	0.03
R2847:Grin2a	UTSW	16	9761965	missense	possibly damaging	0.73
R2848:Grin2a	UTSW	16	9761965	missense	possibly damaging	0.73
R2981:Grin2a	UTSW	16	9644223	missense	possibly damaging	0.89
R4197:Grin2a	UTSW	16	9761967	missense	probably damaging	1.00
R4342:Grin2a	UTSW	16	9653589	missense	possibly damaging	0.52
R4741:Grin2a	UTSW	16	9663512	missense	probably damaging	1.00
R4891:Grin2a	UTSW	16	9657706	missense	possibly damaging	0.51
R4925:Grin2a	UTSW	16	9669823	missense	probably damaging	0.98
R5563:Grin2a	UTSW	16	9707717	missense	probably benign	0.18
R5645:Grin2a	UTSW	16	9992226	missense	probably damaging	0.98
R5769:Grin2a	UTSW	16	9761526	missense	possibly damaging	0.89
R5885:Grin2a	UTSW	16	9761905	missense	possibly damaging	0.95
R6065:Grin2a	UTSW	16	9761907	missense	possibly damaging	0.92
R6083:Grin2a	UTSW	16	9579540	missense	probably benign	0.02
R6137:Grin2a	UTSW	16	9653449	missense	probably benign	0.32
R6286:Grin2a	UTSW	16	9761775	missense	possibly damaging	0.93
R6342:Grin2a	UTSW	16	9579334	missense	probably damaging	0.98
R6697:Grin2a	UTSW	16	9669840	missense	possibly damaging	0.85
R7070:Grin2a	UTSW	16	9579424	missense	possibly damaging	0.92
R7235:Grin2a	UTSW	16	9579265	missense	probably damaging	0.98
R7274:Grin2a	UTSW	16	9579122	missense	possibly damaging	0.71
R7669:Grin2a	UTSW	16	9992463	missense	probably benign
R7990:Grin2a	UTSW	16	9579176	missense	possibly damaging	0.71
R8261:Grin2a	UTSW	16	9663518	missense	probably damaging	0.97
R8503:Grin2a	UTSW	16	9663549	missense	probably damaging	0.97
R8679:Grin2a	UTSW	16	9585225	missense	possibly damaging	0.90
R8700:Grin2a	UTSW	16	9579548	missense	probably benign	0.32
R8823:Grin2a	UTSW	16	9669894	missense	possibly damaging	0.96
R9122:Grin2a	UTSW	16	9579322	missense	possibly damaging	0.93
R9656:Grin2a	UTSW	16	9579607	missense	possibly damaging	0.71
R9674:Grin2a	UTSW	16	9653401	nonsense	probably null
R9786:Grin2a	UTSW	16	9653602	missense	possibly damaging	0.71
X0024:Grin2a	UTSW	16	9663199	missense	probably benign	0.36
Z1177:Grin2a	UTSW	16	9663577	missense	possibly damaging	0.74

Predicted Primers

PCR Primer
(F):5'- GTGGAGCGAATTCAGTTTCCC -3'
(R):5'- AGTCATCTTTGTTACCTCCAGG -3'

Sequencing Primer
(F):5'- GTTTCCCACTCTTACACAGCAAG -3'
(R):5'- AGGTTCTCATTCCAACAGGG -3'

Posted On

2018-11-06