Incidental Mutation 'R6924:Grin2a'
ID539813
Institutional Source Beutler Lab
Gene Symbol Grin2a
Ensembl Gene ENSMUSG00000059003
Gene Nameglutamate receptor, ionotropic, NMDA2A (epsilon 1)
SynonymsNR2A, GluRepsilon1, NMDAR2A, GluN2A
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.491) question?
Stock #R6924 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location9567898-9995560 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 9663228 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 535 (V535A)
Ref Sequence ENSEMBL: ENSMUSP00000142900 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032331] [ENSMUST00000115835] [ENSMUST00000199708]
Predicted Effect possibly damaging
Transcript: ENSMUST00000032331
AA Change: V535A

PolyPhen 2 Score 0.712 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000032331
Gene: ENSMUSG00000059003
AA Change: V535A

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:ANF_receptor 106 301 1.6e-10 PFAM
PBPe 431 798 1.68e-70 SMART
Lig_chan-Glu_bd 439 502 2.24e-22 SMART
transmembrane domain 818 837 N/A INTRINSIC
Pfam:NMDAR2_C 839 1464 2.1e-230 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000115835
AA Change: V535A

PolyPhen 2 Score 0.712 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000111501
Gene: ENSMUSG00000059003
AA Change: V535A

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:ANF_receptor 99 300 9.2e-11 PFAM
PBPe 431 798 1.68e-70 SMART
Lig_chan-Glu_bd 439 502 2.24e-22 SMART
transmembrane domain 818 837 N/A INTRINSIC
Pfam:NMDAR2_C 839 1464 1.2e-266 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000199708
AA Change: V535A

PolyPhen 2 Score 0.712 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000142900
Gene: ENSMUSG00000059003
AA Change: V535A

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:ANF_receptor 106 301 1.6e-10 PFAM
PBPe 431 798 1.68e-70 SMART
Lig_chan-Glu_bd 439 502 2.24e-22 SMART
transmembrane domain 818 837 N/A INTRINSIC
Pfam:NMDAR2_C 839 1464 2.1e-230 PFAM
Meta Mutation Damage Score 0.8688 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.8%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the glutamate-gated ion channel protein family. The encoded protein is an N-methyl-D-aspartate (NMDA) receptor subunit. NMDA receptors are both ligand-gated and voltage-dependent, and are involved in long-term potentiation, an activity-dependent increase in the efficiency of synaptic transmission thought to underlie certain kinds of memory and learning. These receptors are permeable to calcium ions, and activation results in a calcium influx into post-synaptic cells, which results in the activation of several signaling cascades. Disruption of this gene is associated with focal epilepsy and speech disorder with or without mental retardation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2014]
PHENOTYPE: Homozygotes for targeted null mutations exhibit jumpiness, mildly impaired long-term potentiation and spatial learning, increased locomotor activity and metabolism of dopamine and serotonin, and loss of analgesic tolerance after repeated morphine doses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700009N14Rik A C 4: 39,450,884 H30P probably damaging Het
Abhd6 A T 14: 8,049,850 H213L possibly damaging Het
Adam22 T A 5: 8,367,322 N40I possibly damaging Het
Ankrd42 A G 7: 92,582,016 probably benign Het
Arhgap40 C T 2: 158,527,146 R63C probably benign Het
Atf7ip T G 6: 136,559,757 probably null Het
Atg7 T C 6: 114,709,211 probably null Het
Car6 A C 4: 150,189,256 probably null Het
Carmil1 A T 13: 24,075,684 C302* probably null Het
Ccdc117 A T 11: 5,534,255 M195K probably benign Het
Cep95 T C 11: 106,811,197 M383T probably damaging Het
Col20a1 A G 2: 180,996,850 E419G probably damaging Het
Cyp2d9 C G 15: 82,455,212 R272G probably damaging Het
Dhx57 A T 17: 80,238,815 M1380K possibly damaging Het
Dnah14 A G 1: 181,627,952 S881G probably benign Het
Fam126a T C 5: 23,986,135 probably null Het
Fcgbp T A 7: 28,093,823 I1084N probably benign Het
Fgf17 A T 14: 70,641,541 C21* probably null Het
Gemin4 A G 11: 76,212,336 L533P probably damaging Het
Gkn3 T C 6: 87,388,802 R12G probably benign Het
Gpr161 G T 1: 165,321,619 R519L possibly damaging Het
Gys1 G A 7: 45,443,635 probably null Het
Hfm1 C T 5: 106,850,410 probably null Het
Hmcn2 T A 2: 31,350,505 probably null Het
Hnrnpul2 T C 19: 8,831,509 Y738H unknown Het
Igsf23 A G 7: 19,941,759 S141P possibly damaging Het
Lamc3 A C 2: 31,938,069 M1423L probably benign Het
Lcmt2 T C 2: 121,140,003 T200A probably benign Het
Lgr4 T C 2: 110,012,439 V899A probably damaging Het
Macf1 T A 4: 123,527,352 R36S possibly damaging Het
Mrgprb8 A G 7: 48,389,123 K181E possibly damaging Het
Muc2 G A 7: 141,697,834 V786M possibly damaging Het
Nacc2 T C 2: 26,090,029 T132A probably damaging Het
Nsmce2 T A 15: 59,378,925 I15K probably damaging Het
Olfr726 A G 14: 50,083,850 I277T possibly damaging Het
Olfr9 T G 10: 128,990,091 Y60D probably damaging Het
Otoa A T 7: 121,131,501 probably null Het
Otogl A G 10: 107,808,641 I1248T probably damaging Het
Ppp1r17 T A 6: 56,026,022 D32E probably damaging Het
Relt A C 7: 100,847,261 V427G probably damaging Het
Ric1 T A 19: 29,569,388 V256D probably damaging Het
Samhd1 T C 2: 157,109,483 T445A probably benign Het
Sepsecs T C 5: 52,664,304 I189V probably benign Het
Shroom3 T A 5: 92,964,403 D1793E probably damaging Het
Sim1 C T 10: 50,908,539 T137I probably benign Het
Stk17b A T 1: 53,761,059 D253E possibly damaging Het
Stmnd1 T C 13: 46,299,493 V215A probably benign Het
Tcl1 A G 12: 105,218,756 L65P probably damaging Het
Tiam2 A C 17: 3,507,795 K1231N probably damaging Het
Tm9sf3 T C 19: 41,218,278 Y476C probably damaging Het
Trim63 T C 4: 134,321,261 S194P probably damaging Het
Ugt1a10 T A 1: 88,055,657 I59N probably damaging Het
Vmn2r65 A G 7: 84,963,990 F7S probably benign Het
Zfp775 T A 6: 48,619,655 H154Q probably damaging Het
Zfp804b C T 5: 6,769,902 V1018I probably benign Het
Other mutations in Grin2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01777:Grin2a APN 16 9644130 missense probably benign 0.29
IGL03288:Grin2a APN 16 9669840 missense possibly damaging 0.85
IGL02796:Grin2a UTSW 16 9585108 missense possibly damaging 0.72
PIT4402001:Grin2a UTSW 16 9644199 missense possibly damaging 0.77
PIT4494001:Grin2a UTSW 16 9585096 missense probably damaging 0.98
R0055:Grin2a UTSW 16 9669807 missense probably damaging 0.99
R0055:Grin2a UTSW 16 9669807 missense probably damaging 0.99
R0164:Grin2a UTSW 16 9994821 critical splice donor site probably null
R0164:Grin2a UTSW 16 9994821 critical splice donor site probably null
R0211:Grin2a UTSW 16 9579173 missense possibly damaging 0.86
R0390:Grin2a UTSW 16 9579585 missense possibly damaging 0.85
R0659:Grin2a UTSW 16 9992472 missense probably damaging 0.98
R0661:Grin2a UTSW 16 9992472 missense probably damaging 0.98
R0734:Grin2a UTSW 16 9579611 missense possibly damaging 0.71
R1524:Grin2a UTSW 16 9663603 missense possibly damaging 0.55
R1542:Grin2a UTSW 16 9579203 missense probably damaging 0.98
R1556:Grin2a UTSW 16 9707715 missense probably benign 0.18
R1605:Grin2a UTSW 16 9663330 missense possibly damaging 0.46
R1792:Grin2a UTSW 16 9992395 missense possibly damaging 0.53
R2024:Grin2a UTSW 16 9644243 missense possibly damaging 0.76
R2057:Grin2a UTSW 16 9669744 missense probably benign 0.14
R2344:Grin2a UTSW 16 9663235 missense probably benign 0.03
R2847:Grin2a UTSW 16 9761965 missense possibly damaging 0.73
R2848:Grin2a UTSW 16 9761965 missense possibly damaging 0.73
R2981:Grin2a UTSW 16 9644223 missense possibly damaging 0.89
R4197:Grin2a UTSW 16 9761967 missense probably damaging 1.00
R4342:Grin2a UTSW 16 9653589 missense possibly damaging 0.52
R4741:Grin2a UTSW 16 9663512 missense probably damaging 1.00
R4891:Grin2a UTSW 16 9657706 missense possibly damaging 0.51
R4925:Grin2a UTSW 16 9669823 missense probably damaging 0.98
R5563:Grin2a UTSW 16 9707717 missense probably benign 0.18
R5645:Grin2a UTSW 16 9992226 missense probably damaging 0.98
R5769:Grin2a UTSW 16 9761526 missense possibly damaging 0.89
R5885:Grin2a UTSW 16 9761905 missense possibly damaging 0.95
R6065:Grin2a UTSW 16 9761907 missense possibly damaging 0.92
R6083:Grin2a UTSW 16 9579540 missense probably benign 0.02
R6137:Grin2a UTSW 16 9653449 missense probably benign 0.32
R6286:Grin2a UTSW 16 9761775 missense possibly damaging 0.93
R6342:Grin2a UTSW 16 9579334 missense probably damaging 0.98
R6697:Grin2a UTSW 16 9669840 missense possibly damaging 0.85
R7070:Grin2a UTSW 16 9579424 missense possibly damaging 0.92
R7235:Grin2a UTSW 16 9579265 missense probably damaging 0.98
R7274:Grin2a UTSW 16 9579122 missense possibly damaging 0.71
R7669:Grin2a UTSW 16 9992463 missense probably benign
X0024:Grin2a UTSW 16 9663199 missense probably benign 0.36
Z1177:Grin2a UTSW 16 9663577 missense possibly damaging 0.74
Predicted Primers PCR Primer
(F):5'- GTGGAGCGAATTCAGTTTCCC -3'
(R):5'- AGTCATCTTTGTTACCTCCAGG -3'

Sequencing Primer
(F):5'- GTTTCCCACTCTTACACAGCAAG -3'
(R):5'- AGGTTCTCATTCCAACAGGG -3'
Posted On2018-11-06