Incidental Mutation 'R6928:Focad'
ID539832
Institutional Source Beutler Lab
Gene Symbol Focad
Ensembl Gene ENSMUSG00000038368
Gene Namefocadhesin
SynonymsBC057079
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.511) question?
Stock #R6928 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location88094629-88411011 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 88348875 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 1041 (D1041G)
Ref Sequence ENSEMBL: ENSMUSP00000124298 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097992] [ENSMUST00000159342]
Predicted Effect unknown
Transcript: ENSMUST00000097992
AA Change: D1127G
SMART Domains Protein: ENSMUSP00000095602
Gene: ENSMUSG00000038368
AA Change: D1127G

DomainStartEndE-ValueType
low complexity region 150 161 N/A INTRINSIC
low complexity region 194 203 N/A INTRINSIC
low complexity region 264 273 N/A INTRINSIC
low complexity region 328 338 N/A INTRINSIC
low complexity region 348 361 N/A INTRINSIC
Pfam:DUF3730 490 714 1.5e-71 PFAM
low complexity region 957 969 N/A INTRINSIC
low complexity region 1032 1047 N/A INTRINSIC
low complexity region 1200 1209 N/A INTRINSIC
Pfam:DUF3028 1210 1798 1.5e-291 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000159342
AA Change: D1041G
SMART Domains Protein: ENSMUSP00000124298
Gene: ENSMUSG00000038368
AA Change: D1041G

DomainStartEndE-ValueType
Pfam:DUF3730 20 250 5.8e-27 PFAM
low complexity region 264 273 N/A INTRINSIC
low complexity region 328 338 N/A INTRINSIC
low complexity region 348 361 N/A INTRINSIC
Pfam:DUF3730 403 633 2.8e-61 PFAM
low complexity region 871 883 N/A INTRINSIC
low complexity region 946 961 N/A INTRINSIC
low complexity region 1114 1123 N/A INTRINSIC
Pfam:DUF3028 1124 1712 N/A PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.1%
  • 20x: 97.5%
Validation Efficiency 98% (62/63)
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcyap1r1 A G 6: 55,479,272 D215G possibly damaging Het
Asb3 A T 11: 30,998,326 M40L probably damaging Het
Aspg G A 12: 112,126,689 V547M possibly damaging Het
Aspm T A 1: 139,480,206 L2277* probably null Het
Atp7b A G 8: 21,994,812 S1295P probably benign Het
Cdca2 A G 14: 67,705,744 S199P probably damaging Het
Cdh1 A G 8: 106,661,010 E514G possibly damaging Het
Cenpk G T 13: 104,228,992 probably benign Het
Col6a5 C A 9: 105,939,919 V398L unknown Het
Colec10 A T 15: 54,462,606 K277N probably damaging Het
Cryzl2 T G 1: 157,470,787 S249A probably benign Het
Cspg4 T A 9: 56,897,880 Y1992N possibly damaging Het
Drd3 G T 16: 43,821,320 R333L probably benign Het
Espl1 C T 15: 102,298,907 R269C probably benign Het
Esr2 C T 12: 76,165,478 C188Y probably damaging Het
Frem3 T C 8: 80,611,282 F68S possibly damaging Het
Gapdh A G 6: 125,162,671 V212A probably damaging Het
Gm10471 A G 5: 26,085,588 probably null Het
Gm3854 T C 7: 6,354,267 Y360H probably damaging Het
Gm4778 T A 3: 94,266,548 C288S probably benign Het
Gm4858 G A 3: 93,073,960 C95Y probably damaging Het
Gzmb T C 14: 56,260,277 K169E probably benign Het
Hexdc T A 11: 121,212,054 F33I possibly damaging Het
Hsd3b6 T C 3: 98,810,953 I32V probably benign Het
Jcad T C 18: 4,673,372 V378A probably benign Het
Kcnmb2 T C 3: 32,199,041 S177P probably benign Het
Lrriq1 A T 10: 103,214,939 S651T possibly damaging Het
Map3k2 T C 18: 32,207,540 probably null Het
Mib1 T G 18: 10,802,282 S870A probably benign Het
Moap1 T A 12: 102,742,612 N226I probably damaging Het
Moxd1 T A 10: 24,300,288 N547K probably damaging Het
Mtmr9 A G 14: 63,543,593 V16A probably benign Het
Nme1 T C 11: 93,959,403 Y151C probably damaging Het
Nwd1 T C 8: 72,682,025 F879L probably benign Het
Nynrin T G 14: 55,863,878 S335A probably benign Het
Olfr1451 A G 19: 12,999,838 N284S probably damaging Het
Olfr1454 A T 19: 13,063,984 H191L probably benign Het
Olfr209 C A 16: 59,361,463 G252C probably damaging Het
Olfr655 A T 7: 104,596,589 Y197* probably null Het
Olfr930 T C 9: 38,930,566 Y132H probably damaging Het
Olfr935 T C 9: 38,994,632 M268V probably benign Het
Pcdhb21 A G 18: 37,514,421 E201G probably damaging Het
Plscr1 T C 9: 92,269,951 V301A possibly damaging Het
Psg28 A T 7: 18,423,078 S411T possibly damaging Het
Rif1 T C 2: 52,095,961 W653R probably damaging Het
Rnd3 T A 2: 51,132,506 I175L probably benign Het
Rtn4 A G 11: 29,706,791 E199G possibly damaging Het
Sgpp1 T C 12: 75,716,570 Y279C probably damaging Het
Slc2a13 A G 15: 91,276,179 I524T probably damaging Het
Spg11 C T 2: 122,069,904 V1556I probably benign Het
Srebf2 C T 15: 82,203,723 R215* probably null Het
Tmem19 T C 10: 115,347,274 N147S possibly damaging Het
Tpr T C 1: 150,408,785 S408P possibly damaging Het
Trav13d-4 C T 14: 53,073,161 T53I probably damaging Het
Trf T A 9: 103,222,108 R168W possibly damaging Het
Trim11 A G 11: 58,988,843 K273R probably damaging Het
Tsacc T A 3: 88,282,940 M68L probably benign Het
Ttn T A 2: 76,754,525 M22110L probably benign Het
Zfp160 G T 17: 21,041,462 G104V probably benign Het
Zranb1 G A 7: 132,966,594 R301H possibly damaging Het
Other mutations in Focad
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00326:Focad APN 4 88357474 missense unknown
IGL00562:Focad APN 4 88348809 missense unknown
IGL00563:Focad APN 4 88348809 missense unknown
IGL00900:Focad APN 4 88129023 missense probably damaging 0.99
IGL00984:Focad APN 4 88344785 missense unknown
IGL01016:Focad APN 4 88392015 missense possibly damaging 0.51
IGL01069:Focad APN 4 88326146 missense unknown
IGL01305:Focad APN 4 88393547 missense probably benign 0.32
IGL01409:Focad APN 4 88342305 missense unknown
IGL01447:Focad APN 4 88326228 missense unknown
IGL01521:Focad APN 4 88410690 makesense probably null
IGL01672:Focad APN 4 88360590 critical splice donor site probably null
IGL01739:Focad APN 4 88370806 missense unknown
IGL02082:Focad APN 4 88230578 nonsense probably null
IGL02139:Focad APN 4 88129054 critical splice donor site probably null
IGL02381:Focad APN 4 88274090 splice site probably benign
IGL02898:Focad APN 4 88391997 missense probably benign 0.02
Microscope UTSW 4 88342204 missense unknown
Objective UTSW 4 88401068 nonsense probably null
ANU22:Focad UTSW 4 88393547 missense probably benign 0.32
R0025:Focad UTSW 4 88408959 missense probably benign 0.02
R0554:Focad UTSW 4 88348889 missense unknown
R0617:Focad UTSW 4 88121288 unclassified probably benign
R0688:Focad UTSW 4 88274213 missense unknown
R0746:Focad UTSW 4 88397214 missense possibly damaging 0.84
R0907:Focad UTSW 4 88278261 critical splice donor site probably null
R1109:Focad UTSW 4 88196747 intron probably benign
R1136:Focad UTSW 4 88326180 missense unknown
R1185:Focad UTSW 4 88178187 missense probably benign 0.40
R1185:Focad UTSW 4 88178187 missense probably benign 0.40
R1185:Focad UTSW 4 88178187 missense probably benign 0.40
R1412:Focad UTSW 4 88278261 critical splice donor site probably null
R1453:Focad UTSW 4 88357442 critical splice acceptor site probably null
R1697:Focad UTSW 4 88408988 missense probably damaging 0.98
R1739:Focad UTSW 4 88397891 missense probably benign 0.05
R1767:Focad UTSW 4 88357468 missense unknown
R1827:Focad UTSW 4 88229383 missense probably benign 0.03
R1866:Focad UTSW 4 88407165 missense possibly damaging 0.92
R1867:Focad UTSW 4 88178089 missense probably damaging 0.99
R1929:Focad UTSW 4 88342212 missense unknown
R1929:Focad UTSW 4 88397179 missense probably benign 0.32
R1937:Focad UTSW 4 88401081 start codon destroyed probably null
R1989:Focad UTSW 4 88232784 critical splice donor site probably null
R2176:Focad UTSW 4 88279244 missense unknown
R2393:Focad UTSW 4 88121330 missense probably damaging 0.96
R2431:Focad UTSW 4 88331027 missense unknown
R3195:Focad UTSW 4 88407351 missense possibly damaging 0.85
R3196:Focad UTSW 4 88407351 missense possibly damaging 0.85
R3730:Focad UTSW 4 88408925 missense possibly damaging 0.52
R3772:Focad UTSW 4 88336161 splice site probably benign
R4391:Focad UTSW 4 88185958 missense probably damaging 1.00
R4491:Focad UTSW 4 88359905 critical splice donor site probably null
R4492:Focad UTSW 4 88359905 critical splice donor site probably null
R4703:Focad UTSW 4 88342321 critical splice donor site probably null
R4788:Focad UTSW 4 88357469 missense unknown
R4923:Focad UTSW 4 88196846 intron probably benign
R5026:Focad UTSW 4 88344582 missense unknown
R5122:Focad UTSW 4 88407365 critical splice donor site probably null
R5153:Focad UTSW 4 88359884 missense unknown
R5369:Focad UTSW 4 88121373 splice site probably benign
R5414:Focad UTSW 4 88410702 utr 3 prime probably benign
R5839:Focad UTSW 4 88196846 intron probably benign
R5916:Focad UTSW 4 88357541 missense unknown
R5953:Focad UTSW 4 88229335 missense probably benign 0.01
R5991:Focad UTSW 4 88401019 missense possibly damaging 0.91
R6230:Focad UTSW 4 88342204 missense unknown
R6247:Focad UTSW 4 88407140 missense possibly damaging 0.92
R6324:Focad UTSW 4 88401068 nonsense probably null
R6543:Focad UTSW 4 88279256 missense unknown
R6639:Focad UTSW 4 88278242 missense unknown
R6802:Focad UTSW 4 88274203 missense unknown
R6802:Focad UTSW 4 88344684 missense unknown
R6866:Focad UTSW 4 88403386 missense probably benign 0.34
R6902:Focad UTSW 4 88230476 missense unknown
R7036:Focad UTSW 4 88124637 missense probably benign 0.05
R7057:Focad UTSW 4 88274105 missense unknown
R7077:Focad UTSW 4 88410677 missense unknown
R7242:Focad UTSW 4 88309906 missense unknown
R7357:Focad UTSW 4 88229335 missense probably benign 0.19
R7380:Focad UTSW 4 88274198 missense unknown
R7427:Focad UTSW 4 88368751 missense unknown
R7582:Focad UTSW 4 88229378 missense probably benign 0.00
R7661:Focad UTSW 4 88303535 missense unknown
R7688:Focad UTSW 4 88178133 missense probably damaging 1.00
R7789:Focad UTSW 4 88229406 missense unknown
R7880:Focad UTSW 4 88401170 missense unknown
R7887:Focad UTSW 4 88182616 missense probably damaging 1.00
R7963:Focad UTSW 4 88401170 missense unknown
R7970:Focad UTSW 4 88182616 missense probably damaging 1.00
R8024:Focad UTSW 4 88397000 missense not run
X0035:Focad UTSW 4 88397922 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- ATCTCTCTGGACCAGAAGGC -3'
(R):5'- ACCGATAGCAGGGTTTAGGAAC -3'

Sequencing Primer
(F):5'- CTTTATGCATACTGGACAAGCACTC -3'
(R):5'- CAAAACAGTTTTGGTGCAAGATTC -3'
Posted On2018-11-06