Incidental Mutation 'R6928:Atp7b'
ID539839
Institutional Source Beutler Lab
Gene Symbol Atp7b
Ensembl Gene ENSMUSG00000006567
Gene NameATPase, Cu++ transporting, beta polypeptide
SynonymsAtp7a, WND, Wilson protein
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.643) question?
Stock #R6928 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location21992785-22060305 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 21994812 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 1295 (S1295P)
Ref Sequence ENSEMBL: ENSMUSP00000106366 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006742] [ENSMUST00000110738]
Predicted Effect probably benign
Transcript: ENSMUST00000006742
AA Change: S1410P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000006742
Gene: ENSMUSG00000006567
AA Change: S1410P

DomainStartEndE-ValueType
Pfam:HMA 71 132 8.8e-14 PFAM
Pfam:HMA 156 217 6.6e-13 PFAM
Pfam:HMA 271 329 7.4e-13 PFAM
Pfam:HMA 364 425 1.1e-10 PFAM
Pfam:HMA 493 554 2.3e-14 PFAM
Pfam:HMA 569 630 3.1e-15 PFAM
transmembrane domain 656 675 N/A INTRINSIC
Pfam:E1-E2_ATPase 770 1018 3.3e-60 PFAM
Pfam:Hydrolase 1023 1276 1.3e-67 PFAM
Pfam:HAD 1026 1273 4.6e-10 PFAM
Pfam:Hydrolase_3 1243 1308 5.1e-7 PFAM
transmembrane domain 1322 1344 N/A INTRINSIC
low complexity region 1353 1370 N/A INTRINSIC
low complexity region 1418 1437 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110738
AA Change: S1295P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000106366
Gene: ENSMUSG00000006567
AA Change: S1295P

DomainStartEndE-ValueType
Pfam:HMA 59 120 1.2e-13 PFAM
Pfam:HMA 144 205 9.7e-12 PFAM
PDB:2AW0|A 259 314 6e-6 PDB
Pfam:HMA 378 439 1.6e-13 PFAM
Pfam:HMA 454 515 1.5e-15 PFAM
transmembrane domain 541 560 N/A INTRINSIC
Pfam:E1-E2_ATPase 656 904 4.6e-50 PFAM
Pfam:Hydrolase 908 1161 6.6e-76 PFAM
Pfam:HAD 911 1158 1.5e-15 PFAM
Pfam:Hydrolase_3 1128 1193 8.5e-7 PFAM
transmembrane domain 1207 1229 N/A INTRINSIC
low complexity region 1238 1255 N/A INTRINSIC
low complexity region 1303 1322 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.1%
  • 20x: 97.5%
Validation Efficiency 98% (62/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the P-type cation transport ATPase family and encodes a protein with several membrane-spanning domains, an ATPase consensus sequence, a hinge domain, a phosphorylation site, and at least 2 putative copper-binding sites. This protein functions as a monomer, exporting copper out of the cells, such as the efflux of hepatic copper into the bile. Alternate transcriptional splice variants, encoding different isoforms with distinct cellular localizations, have been characterized. Mutations in this gene have been associated with Wilson disease (WD). [provided by RefSeq, Jul 2008]
PHENOTYPE: Targeted disruption of the mouse gene results in copper accumulation in various organs, primarily the liver, kidney and brain, and a form of liver cirrhosis that resembles Wilson disease in humans and the 'toxic milk' phenotype in mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcyap1r1 A G 6: 55,479,272 D215G possibly damaging Het
Asb3 A T 11: 30,998,326 M40L probably damaging Het
Aspg G A 12: 112,126,689 V547M possibly damaging Het
Aspm T A 1: 139,480,206 L2277* probably null Het
Cdca2 A G 14: 67,705,744 S199P probably damaging Het
Cdh1 A G 8: 106,661,010 E514G possibly damaging Het
Cenpk G T 13: 104,228,992 probably benign Het
Col6a5 C A 9: 105,939,919 V398L unknown Het
Colec10 A T 15: 54,462,606 K277N probably damaging Het
Cryzl2 T G 1: 157,470,787 S249A probably benign Het
Cspg4 T A 9: 56,897,880 Y1992N possibly damaging Het
Drd3 G T 16: 43,821,320 R333L probably benign Het
Espl1 C T 15: 102,298,907 R269C probably benign Het
Esr2 C T 12: 76,165,478 C188Y probably damaging Het
Focad A G 4: 88,348,875 D1041G unknown Het
Frem3 T C 8: 80,611,282 F68S possibly damaging Het
Gapdh A G 6: 125,162,671 V212A probably damaging Het
Gm10471 A G 5: 26,085,588 probably null Het
Gm3854 T C 7: 6,354,267 Y360H probably damaging Het
Gm4778 T A 3: 94,266,548 C288S probably benign Het
Gm4858 G A 3: 93,073,960 C95Y probably damaging Het
Gzmb T C 14: 56,260,277 K169E probably benign Het
Hexdc T A 11: 121,212,054 F33I possibly damaging Het
Hsd3b6 T C 3: 98,810,953 I32V probably benign Het
Jcad T C 18: 4,673,372 V378A probably benign Het
Kcnmb2 T C 3: 32,199,041 S177P probably benign Het
Lrriq1 A T 10: 103,214,939 S651T possibly damaging Het
Map3k2 T C 18: 32,207,540 probably null Het
Mib1 T G 18: 10,802,282 S870A probably benign Het
Moap1 T A 12: 102,742,612 N226I probably damaging Het
Moxd1 T A 10: 24,300,288 N547K probably damaging Het
Mtmr9 A G 14: 63,543,593 V16A probably benign Het
Nme1 T C 11: 93,959,403 Y151C probably damaging Het
Nwd1 T C 8: 72,682,025 F879L probably benign Het
Nynrin T G 14: 55,863,878 S335A probably benign Het
Olfr1451 A G 19: 12,999,838 N284S probably damaging Het
Olfr1454 A T 19: 13,063,984 H191L probably benign Het
Olfr209 C A 16: 59,361,463 G252C probably damaging Het
Olfr655 A T 7: 104,596,589 Y197* probably null Het
Olfr930 T C 9: 38,930,566 Y132H probably damaging Het
Olfr935 T C 9: 38,994,632 M268V probably benign Het
Pcdhb21 A G 18: 37,514,421 E201G probably damaging Het
Plscr1 T C 9: 92,269,951 V301A possibly damaging Het
Psg28 A T 7: 18,423,078 S411T possibly damaging Het
Rif1 T C 2: 52,095,961 W653R probably damaging Het
Rnd3 T A 2: 51,132,506 I175L probably benign Het
Rtn4 A G 11: 29,706,791 E199G possibly damaging Het
Sgpp1 T C 12: 75,716,570 Y279C probably damaging Het
Slc2a13 A G 15: 91,276,179 I524T probably damaging Het
Spg11 C T 2: 122,069,904 V1556I probably benign Het
Srebf2 C T 15: 82,203,723 R215* probably null Het
Tmem19 T C 10: 115,347,274 N147S possibly damaging Het
Tpr T C 1: 150,408,785 S408P possibly damaging Het
Trav13d-4 C T 14: 53,073,161 T53I probably damaging Het
Trf T A 9: 103,222,108 R168W possibly damaging Het
Trim11 A G 11: 58,988,843 K273R probably damaging Het
Tsacc T A 3: 88,282,940 M68L probably benign Het
Ttn T A 2: 76,754,525 M22110L probably benign Het
Zfp160 G T 17: 21,041,462 G104V probably benign Het
Zranb1 G A 7: 132,966,594 R301H possibly damaging Het
Other mutations in Atp7b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00932:Atp7b APN 8 22011098 missense possibly damaging 0.91
IGL00981:Atp7b APN 8 22027527 splice site probably null
IGL01600:Atp7b APN 8 22027525 splice site probably null
IGL01713:Atp7b APN 8 22028573 missense probably damaging 1.00
IGL01778:Atp7b APN 8 21994828 missense probably benign 0.42
IGL01926:Atp7b APN 8 22011781 missense probably damaging 0.98
IGL02312:Atp7b APN 8 21994770 missense probably damaging 0.99
IGL02562:Atp7b APN 8 22028085 missense probably benign
IGL02573:Atp7b APN 8 22022470 missense probably benign 0.00
IGL02603:Atp7b APN 8 21994776 missense possibly damaging 0.88
IGL02622:Atp7b APN 8 22028438 missense possibly damaging 0.69
IGL02721:Atp7b APN 8 22022477 missense probably benign 0.00
IGL03145:Atp7b APN 8 22018143 missense probably damaging 1.00
daffodil UTSW 8 21998266 missense probably damaging 1.00
menace UTSW 8 22022365 missense probably damaging 0.97
PIT4131001:Atp7b UTSW 8 21994656 missense probably damaging 1.00
R0023:Atp7b UTSW 8 22011073 missense probably damaging 1.00
R0046:Atp7b UTSW 8 22059995 missense probably benign 0.00
R0128:Atp7b UTSW 8 22028172 missense possibly damaging 0.47
R0130:Atp7b UTSW 8 22028172 missense possibly damaging 0.47
R0325:Atp7b UTSW 8 22028451 missense probably benign 0.22
R0412:Atp7b UTSW 8 21995659 splice site probably null
R0856:Atp7b UTSW 8 21997631 missense probably damaging 1.00
R0906:Atp7b UTSW 8 22027826 missense probably benign
R0989:Atp7b UTSW 8 22028694 missense possibly damaging 0.51
R1377:Atp7b UTSW 8 22011785 missense probably benign 0.17
R1517:Atp7b UTSW 8 21997358 missense probably damaging 1.00
R1521:Atp7b UTSW 8 22027673 missense probably damaging 0.96
R1529:Atp7b UTSW 8 22028724 missense possibly damaging 0.87
R1691:Atp7b UTSW 8 22011023 missense possibly damaging 0.90
R1743:Atp7b UTSW 8 22006387 missense probably damaging 1.00
R1815:Atp7b UTSW 8 22011651 missense possibly damaging 0.80
R2008:Atp7b UTSW 8 22027980 missense probably damaging 1.00
R2133:Atp7b UTSW 8 22011077 missense probably damaging 1.00
R2155:Atp7b UTSW 8 22013584 missense possibly damaging 0.69
R2182:Atp7b UTSW 8 22014547 missense probably damaging 0.99
R2256:Atp7b UTSW 8 21998266 missense probably damaging 1.00
R2257:Atp7b UTSW 8 21998266 missense probably damaging 1.00
R2274:Atp7b UTSW 8 22020832 missense probably benign 0.20
R2475:Atp7b UTSW 8 21994776 missense possibly damaging 0.88
R2906:Atp7b UTSW 8 22011554 missense probably damaging 1.00
R2907:Atp7b UTSW 8 22011554 missense probably damaging 1.00
R3421:Atp7b UTSW 8 22028670 missense probably damaging 1.00
R3422:Atp7b UTSW 8 22028670 missense probably damaging 1.00
R3688:Atp7b UTSW 8 22004230 missense probably damaging 1.00
R3945:Atp7b UTSW 8 22020864 missense probably benign 0.02
R4235:Atp7b UTSW 8 22011023 missense possibly damaging 0.90
R4700:Atp7b UTSW 8 22000121 missense probably benign 0.00
R4701:Atp7b UTSW 8 22000121 missense probably benign 0.00
R4877:Atp7b UTSW 8 22028601 missense probably damaging 0.98
R4962:Atp7b UTSW 8 22020885 missense probably damaging 1.00
R5009:Atp7b UTSW 8 22027698 missense possibly damaging 0.88
R5016:Atp7b UTSW 8 22015869 splice site probably null
R5038:Atp7b UTSW 8 22028456 missense possibly damaging 0.67
R5438:Atp7b UTSW 8 22014554 missense probably benign
R5467:Atp7b UTSW 8 22011554 missense probably damaging 1.00
R5468:Atp7b UTSW 8 22059970 critical splice donor site probably null
R5512:Atp7b UTSW 8 22012739 missense probably benign 0.20
R5563:Atp7b UTSW 8 22028714 missense possibly damaging 0.82
R5751:Atp7b UTSW 8 22018128 missense probably damaging 1.00
R5773:Atp7b UTSW 8 22027863 missense probably benign
R5941:Atp7b UTSW 8 21997496 missense probably damaging 0.98
R6227:Atp7b UTSW 8 22020825 missense possibly damaging 0.63
R6265:Atp7b UTSW 8 22015927 nonsense probably null
R6290:Atp7b UTSW 8 22020820 missense probably damaging 1.00
R6368:Atp7b UTSW 8 22020755 splice site probably null
R6647:Atp7b UTSW 8 22028478 missense probably damaging 1.00
R6788:Atp7b UTSW 8 22004375 missense probably benign 0.37
R6830:Atp7b UTSW 8 22022365 missense probably damaging 0.97
R6886:Atp7b UTSW 8 22028690 missense probably benign 0.01
R6965:Atp7b UTSW 8 22028085 missense probably benign
R7203:Atp7b UTSW 8 21997335 missense probably damaging 1.00
R7222:Atp7b UTSW 8 22022378 nonsense probably null
R7344:Atp7b UTSW 8 21997499 missense probably damaging 1.00
R7384:Atp7b UTSW 8 22022315 missense probably benign 0.01
R7449:Atp7b UTSW 8 22011849 missense probably damaging 0.98
R7451:Atp7b UTSW 8 22014684 nonsense probably null
R7607:Atp7b UTSW 8 22011506 missense probably damaging 1.00
R8140:Atp7b UTSW 8 22028560 missense probably damaging 1.00
Z1176:Atp7b UTSW 8 22028714 missense probably benign 0.07
Z1177:Atp7b UTSW 8 21994877 missense probably benign
Predicted Primers PCR Primer
(F):5'- AACACTCAGATGCACTGCTC -3'
(R):5'- CTTGAACCATGGGAATTCAGTATCC -3'

Sequencing Primer
(F):5'- AGATGCACTGCTCTTCATCC -3'
(R):5'- ACTGAAAAATAGAGATTTCACCAGAG -3'
Posted On2018-11-06