Incidental Mutation 'R6928:Aspg'
ID539860
Institutional Source Beutler Lab
Gene Symbol Aspg
Ensembl Gene ENSMUSG00000037686
Gene Nameasparaginase
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.160) question?
Stock #R6928 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location112106679-112127559 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 112126689 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 547 (V547M)
Ref Sequence ENSEMBL: ENSMUSP00000078369 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079400] [ENSMUST00000223184]
Predicted Effect possibly damaging
Transcript: ENSMUST00000079400
AA Change: V547M

PolyPhen 2 Score 0.522 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000078369
Gene: ENSMUSG00000037686
AA Change: V547M

DomainStartEndE-ValueType
Asparaginase 10 348 2.67e-111 SMART
ANK 396 426 4.05e2 SMART
ANK 430 459 4.46e-7 SMART
ANK 463 494 1.1e2 SMART
ANK 530 559 4.73e2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000222970
Predicted Effect probably benign
Transcript: ENSMUST00000223184
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.1%
  • 20x: 97.5%
Validation Efficiency 98% (62/63)
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcyap1r1 A G 6: 55,479,272 D215G possibly damaging Het
Asb3 A T 11: 30,998,326 M40L probably damaging Het
Aspm T A 1: 139,480,206 L2277* probably null Het
Atp7b A G 8: 21,994,812 S1295P probably benign Het
Cdca2 A G 14: 67,705,744 S199P probably damaging Het
Cdh1 A G 8: 106,661,010 E514G possibly damaging Het
Cenpk G T 13: 104,228,992 probably benign Het
Col6a5 C A 9: 105,939,919 V398L unknown Het
Colec10 A T 15: 54,462,606 K277N probably damaging Het
Cryzl2 T G 1: 157,470,787 S249A probably benign Het
Cspg4 T A 9: 56,897,880 Y1992N possibly damaging Het
Drd3 G T 16: 43,821,320 R333L probably benign Het
Espl1 C T 15: 102,298,907 R269C probably benign Het
Esr2 C T 12: 76,165,478 C188Y probably damaging Het
Focad A G 4: 88,348,875 D1041G unknown Het
Frem3 T C 8: 80,611,282 F68S possibly damaging Het
Gapdh A G 6: 125,162,671 V212A probably damaging Het
Gm10471 A G 5: 26,085,588 probably null Het
Gm3854 T C 7: 6,354,267 Y360H probably damaging Het
Gm4778 T A 3: 94,266,548 C288S probably benign Het
Gm4858 G A 3: 93,073,960 C95Y probably damaging Het
Gzmb T C 14: 56,260,277 K169E probably benign Het
Hexdc T A 11: 121,212,054 F33I possibly damaging Het
Hsd3b6 T C 3: 98,810,953 I32V probably benign Het
Jcad T C 18: 4,673,372 V378A probably benign Het
Kcnmb2 T C 3: 32,199,041 S177P probably benign Het
Lrriq1 A T 10: 103,214,939 S651T possibly damaging Het
Map3k2 T C 18: 32,207,540 probably null Het
Mib1 T G 18: 10,802,282 S870A probably benign Het
Moap1 T A 12: 102,742,612 N226I probably damaging Het
Moxd1 T A 10: 24,300,288 N547K probably damaging Het
Mtmr9 A G 14: 63,543,593 V16A probably benign Het
Nme1 T C 11: 93,959,403 Y151C probably damaging Het
Nwd1 T C 8: 72,682,025 F879L probably benign Het
Nynrin T G 14: 55,863,878 S335A probably benign Het
Olfr1451 A G 19: 12,999,838 N284S probably damaging Het
Olfr1454 A T 19: 13,063,984 H191L probably benign Het
Olfr209 C A 16: 59,361,463 G252C probably damaging Het
Olfr655 A T 7: 104,596,589 Y197* probably null Het
Olfr930 T C 9: 38,930,566 Y132H probably damaging Het
Olfr935 T C 9: 38,994,632 M268V probably benign Het
Pcdhb21 A G 18: 37,514,421 E201G probably damaging Het
Plscr1 T C 9: 92,269,951 V301A possibly damaging Het
Psg28 A T 7: 18,423,078 S411T possibly damaging Het
Rif1 T C 2: 52,095,961 W653R probably damaging Het
Rnd3 T A 2: 51,132,506 I175L probably benign Het
Rtn4 A G 11: 29,706,791 E199G possibly damaging Het
Sgpp1 T C 12: 75,716,570 Y279C probably damaging Het
Slc2a13 A G 15: 91,276,179 I524T probably damaging Het
Spg11 C T 2: 122,069,904 V1556I probably benign Het
Srebf2 C T 15: 82,203,723 R215* probably null Het
Tmem19 T C 10: 115,347,274 N147S possibly damaging Het
Tpr T C 1: 150,408,785 S408P possibly damaging Het
Trav13d-4 C T 14: 53,073,161 T53I probably damaging Het
Trf T A 9: 103,222,108 R168W possibly damaging Het
Trim11 A G 11: 58,988,843 K273R probably damaging Het
Tsacc T A 3: 88,282,940 M68L probably benign Het
Ttn T A 2: 76,754,525 M22110L probably benign Het
Zfp160 G T 17: 21,041,462 G104V probably benign Het
Zranb1 G A 7: 132,966,594 R301H possibly damaging Het
Other mutations in Aspg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01462:Aspg APN 12 112122953 missense probably benign
IGL02199:Aspg APN 12 112120992 missense probably benign 0.39
R0704:Aspg UTSW 12 112114472 missense probably damaging 1.00
R0730:Aspg UTSW 12 112112259 nonsense probably null
R1196:Aspg UTSW 12 112116524 missense possibly damaging 0.94
R1270:Aspg UTSW 12 112116447 missense probably damaging 1.00
R1466:Aspg UTSW 12 112121852 missense probably benign 0.20
R1466:Aspg UTSW 12 112121852 missense probably benign 0.20
R1592:Aspg UTSW 12 112119972 missense probably benign 0.17
R1826:Aspg UTSW 12 112123418 missense probably damaging 0.99
R1859:Aspg UTSW 12 112121172 missense possibly damaging 0.86
R2124:Aspg UTSW 12 112121174 missense probably benign 0.15
R2154:Aspg UTSW 12 112120974 missense probably benign 0.01
R2190:Aspg UTSW 12 112124888 missense probably damaging 0.96
R2221:Aspg UTSW 12 112114434 missense probably damaging 1.00
R2223:Aspg UTSW 12 112114434 missense probably damaging 1.00
R3907:Aspg UTSW 12 112112259 nonsense probably null
R4234:Aspg UTSW 12 112123316 nonsense probably null
R4258:Aspg UTSW 12 112121253 missense probably benign 0.00
R4270:Aspg UTSW 12 112121195 missense probably damaging 1.00
R4271:Aspg UTSW 12 112121195 missense probably damaging 1.00
R5386:Aspg UTSW 12 112123032 missense probably benign 0.01
R5431:Aspg UTSW 12 112123412 missense probably benign 0.13
R5458:Aspg UTSW 12 112120002 missense probably damaging 0.99
R5941:Aspg UTSW 12 112113085 missense probably benign 0.02
R6003:Aspg UTSW 12 112113042 missense probably damaging 1.00
R6057:Aspg UTSW 12 112120998 missense probably damaging 0.96
R6979:Aspg UTSW 12 112120944 missense possibly damaging 0.77
R6998:Aspg UTSW 12 112112194 missense probably damaging 1.00
R7054:Aspg UTSW 12 112126390 missense probably damaging 0.98
R7060:Aspg UTSW 12 112122953 missense probably benign
R7124:Aspg UTSW 12 112122983 missense probably damaging 0.99
R7137:Aspg UTSW 12 112112198 missense possibly damaging 0.92
R7439:Aspg UTSW 12 112124821 missense possibly damaging 0.90
R7441:Aspg UTSW 12 112124821 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- CAAGTAGTGAGTGCCTACCTCC -3'
(R):5'- CGGATGACACGTCTCCCATATC -3'

Sequencing Primer
(F):5'- ACTCCTCCTAGGGAAATAACTTTC -3'
(R):5'- GATGACACGTCTCCCATATCCTCTTC -3'
Posted On2018-11-06