Mutagenetix > Incidental Mutations

Incidental Mutation 'R6928:Espl1'

539870

Institutional Source

Beutler Lab

Gene Symbol

Espl1

Ensembl Gene

ENSMUSG00000058290

Gene Name

extra spindle pole bodies 1, separase

Synonyms

SSE, ESP1, PRCE, Cerp, PRCE, separase

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R6928 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

102296266-102324357 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 102298907 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Cysteine at position 269 (R269C)

Ref Sequence

ENSEMBL: ENSMUSP00000155304 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000064924] [ENSMUST00000229050] [ENSMUST00000230212] [ENSMUST00000231104]

AlphaFold

P60330

Predicted Effect

probably benign
Transcript: ENSMUST00000064924
AA Change: R269C

PolyPhen 2 Score 0.285 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000064465
Gene: ENSMUSG00000058290
AA Change: R269C

Domain	Start	End	E-Value	Type
low complexity region	236	245	N/A	INTRINSIC
low complexity region	433	445	N/A	INTRINSIC
low complexity region	785	794	N/A	INTRINSIC
low complexity region	907	918	N/A	INTRINSIC
low complexity region	1312	1317	N/A	INTRINSIC
low complexity region	1565	1579	N/A	INTRINSIC
low complexity region	1625	1636	N/A	INTRINSIC
Pfam:Peptidase_C50	1716	2065	4.2e-93	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000229050
AA Change: R269C

PolyPhen 2 Score 0.285 (Sensitivity: 0.91; Specificity: 0.88)

Predicted Effect

probably benign
Transcript: ENSMUST00000230212

Predicted Effect

probably benign
Transcript: ENSMUST00000231104

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.1%
20x: 97.5%

Validation Efficiency

98% (62/63)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Stable cohesion between sister chromatids before anaphase and their timely separation during anaphase are critical for chromosome inheritance. In vertebrates, sister chromatid cohesion is released in 2 steps via distinct mechanisms. The first step involves phosphorylation of STAG1 (MIM 604358) or STAG2 (MIM 300826) in the cohesin complex. The second step involves cleavage of the cohesin subunit SCC1 (RAD21; MIM 606462) by ESPL1, or separase, which initiates the final separation of sister chromatids (Sun et al., 2009 [PubMed 19345191]).[supplied by OMIM, Nov 2010]
PHENOTYPE: Homozygous null mice display embryonic lethality before somite formation. Conditional null mice display abnormal mitosis during liver regeneration. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adcyap1r1	A	G	6: 55,479,272	D215G	possibly damaging	Het
Asb3	A	T	11: 30,998,326	M40L	probably damaging	Het
Aspg	G	A	12: 112,126,689	V547M	possibly damaging	Het
Aspm	T	A	1: 139,480,206	L2277*	probably null	Het
Atp7b	A	G	8: 21,994,812	S1295P	probably benign	Het
Cdca2	A	G	14: 67,705,744	S199P	probably damaging	Het
Cdh1	A	G	8: 106,661,010	E514G	possibly damaging	Het
Cenpk	G	T	13: 104,228,992		probably benign	Het
Col6a5	C	A	9: 105,939,919	V398L	unknown	Het
Colec10	A	T	15: 54,462,606	K277N	probably damaging	Het
Cryzl2	T	G	1: 157,470,787	S249A	probably benign	Het
Cspg4	T	A	9: 56,897,880	Y1992N	possibly damaging	Het
Drd3	G	T	16: 43,821,320	R333L	probably benign	Het
Esr2	C	T	12: 76,165,478	C188Y	probably damaging	Het
Focad	A	G	4: 88,348,875	D1041G	unknown	Het
Frem3	T	C	8: 80,611,282	F68S	possibly damaging	Het
Gapdh	A	G	6: 125,162,671	V212A	probably damaging	Het
Gm10471	A	G	5: 26,085,588		probably null	Het
Gm3854	T	C	7: 6,354,267	Y360H	probably damaging	Het
Gm4778	T	A	3: 94,266,548	C288S	probably benign	Het
Gm4858	G	A	3: 93,073,960	C95Y	probably damaging	Het
Gzmb	T	C	14: 56,260,277	K169E	probably benign	Het
Hexdc	T	A	11: 121,212,054	F33I	possibly damaging	Het
Hsd3b6	T	C	3: 98,810,953	I32V	probably benign	Het
Jcad	T	C	18: 4,673,372	V378A	probably benign	Het
Kcnmb2	T	C	3: 32,199,041	S177P	probably benign	Het
Lrriq1	A	T	10: 103,214,939	S651T	possibly damaging	Het
Map3k2	T	C	18: 32,207,540		probably null	Het
Mib1	T	G	18: 10,802,282	S870A	probably benign	Het
Moap1	T	A	12: 102,742,612	N226I	probably damaging	Het
Moxd1	T	A	10: 24,300,288	N547K	probably damaging	Het
Mtmr9	A	G	14: 63,543,593	V16A	probably benign	Het
Nme1	T	C	11: 93,959,403	Y151C	probably damaging	Het
Nwd1	T	C	8: 72,682,025	F879L	probably benign	Het
Nynrin	T	G	14: 55,863,878	S335A	probably benign	Het
Olfr1451	A	G	19: 12,999,838	N284S	probably damaging	Het
Olfr1454	A	T	19: 13,063,984	H191L	probably benign	Het
Olfr209	C	A	16: 59,361,463	G252C	probably damaging	Het
Olfr655	A	T	7: 104,596,589	Y197*	probably null	Het
Olfr930	T	C	9: 38,930,566	Y132H	probably damaging	Het
Olfr935	T	C	9: 38,994,632	M268V	probably benign	Het
Pcdhb21	A	G	18: 37,514,421	E201G	probably damaging	Het
Plscr1	T	C	9: 92,269,951	V301A	possibly damaging	Het
Psg28	A	T	7: 18,423,078	S411T	possibly damaging	Het
Rif1	T	C	2: 52,095,961	W653R	probably damaging	Het
Rnd3	T	A	2: 51,132,506	I175L	probably benign	Het
Rtn4	A	G	11: 29,706,791	E199G	possibly damaging	Het
Sgpp1	T	C	12: 75,716,570	Y279C	probably damaging	Het
Slc2a13	A	G	15: 91,276,179	I524T	probably damaging	Het
Spg11	C	T	2: 122,069,904	V1556I	probably benign	Het
Srebf2	C	T	15: 82,203,723	R215*	probably null	Het
Tmem19	T	C	10: 115,347,274	N147S	possibly damaging	Het
Tpr	T	C	1: 150,408,785	S408P	possibly damaging	Het
Trav13d-4	C	T	14: 53,073,161	T53I	probably damaging	Het
Trf	T	A	9: 103,222,108	R168W	possibly damaging	Het
Trim11	A	G	11: 58,988,843	K273R	probably damaging	Het
Tsacc	T	A	3: 88,282,940	M68L	probably benign	Het
Ttn	T	A	2: 76,754,525	M22110L	probably benign	Het
Zfp160	G	T	17: 21,041,462	G104V	probably benign	Het
Zranb1	G	A	7: 132,966,594	R301H	possibly damaging	Het

Other mutations in Espl1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00821:Espl1	APN	15	102299813	missense	probably damaging	1.00
IGL00839:Espl1	APN	15	102320547	unclassified	probably benign
IGL00919:Espl1	APN	15	102298629	missense	probably benign	0.03
IGL01125:Espl1	APN	15	102322938	missense	probably damaging	1.00
IGL01366:Espl1	APN	15	102319836	missense	probably benign	0.00
IGL01488:Espl1	APN	15	102298739	missense	probably benign
IGL01554:Espl1	APN	15	102313225	missense	probably damaging	1.00
IGL01810:Espl1	APN	15	102298205	missense	probably benign
IGL01959:Espl1	APN	15	102305662	splice site	probably benign
IGL02267:Espl1	APN	15	102315664	missense	probably benign	0.01
IGL02452:Espl1	APN	15	102299839	missense	probably damaging	1.00
IGL02469:Espl1	APN	15	102314025	missense	probably damaging	1.00
IGL02500:Espl1	APN	15	102315800	missense	probably benign
IGL02630:Espl1	APN	15	102296818	missense	probably benign	0.11
IGL02687:Espl1	APN	15	102313178	splice site	probably benign
IGL02868:Espl1	APN	15	102313990	nonsense	probably null
IGL02926:Espl1	APN	15	102299855	missense	probably damaging	0.99
R0019:Espl1	UTSW	15	102306319	missense	probably null	0.01
R0129:Espl1	UTSW	15	102316648	missense	probably benign	0.00
R0184:Espl1	UTSW	15	102299216	missense	probably benign	0.01
R0240:Espl1	UTSW	15	102312541	missense	probably benign	0.00
R0240:Espl1	UTSW	15	102312541	missense	probably benign	0.00
R0267:Espl1	UTSW	15	102313017	missense	possibly damaging	0.89
R0423:Espl1	UTSW	15	102303986	nonsense	probably null
R0587:Espl1	UTSW	15	102303947	splice site	probably benign
R0726:Espl1	UTSW	15	102322598	missense	probably benign
R1186:Espl1	UTSW	15	102304039	missense	probably benign	0.05
R1282:Espl1	UTSW	15	102315391	missense	probably benign	0.00
R1428:Espl1	UTSW	15	102305685	missense	probably benign	0.06
R1467:Espl1	UTSW	15	102319858	missense	probably benign	0.09
R1467:Espl1	UTSW	15	102319858	missense	probably benign	0.09
R1473:Espl1	UTSW	15	102320443	missense	possibly damaging	0.63
R1570:Espl1	UTSW	15	102298367	missense	probably damaging	0.98
R1639:Espl1	UTSW	15	102320714	missense	probably damaging	1.00
R1725:Espl1	UTSW	15	102313221	missense	probably benign	0.08
R1748:Espl1	UTSW	15	102298529	missense	possibly damaging	0.92
R1845:Espl1	UTSW	15	102299013	missense	probably benign
R1938:Espl1	UTSW	15	102305042	missense	probably benign	0.00
R1954:Espl1	UTSW	15	102298388	missense	probably damaging	1.00
R2009:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R2014:Espl1	UTSW	15	102322714	nonsense	probably null
R2067:Espl1	UTSW	15	102299090	missense	probably damaging	0.96
R2084:Espl1	UTSW	15	102296851	critical splice donor site	probably null
R2164:Espl1	UTSW	15	102319588	missense	probably damaging	1.00
R2204:Espl1	UTSW	15	102305905	missense	probably damaging	1.00
R2220:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R2237:Espl1	UTSW	15	102315569	missense	probably damaging	0.98
R2314:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3107:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3108:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3114:Espl1	UTSW	15	102323204	missense	possibly damaging	0.89
R3115:Espl1	UTSW	15	102323204	missense	possibly damaging	0.89
R3615:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3616:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3732:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3732:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3733:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3958:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3959:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3960:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4062:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4063:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4064:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4165:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4166:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4349:Espl1	UTSW	15	102319604	missense	probably benign	0.26
R4373:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4376:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4377:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4516:Espl1	UTSW	15	102323236	missense	probably benign	0.00
R4595:Espl1	UTSW	15	102298724	missense	probably benign	0.01
R4884:Espl1	UTSW	15	102324070	missense	possibly damaging	0.84
R4894:Espl1	UTSW	15	102322323	critical splice acceptor site	probably null
R4921:Espl1	UTSW	15	102315241	missense	probably damaging	0.98
R4931:Espl1	UTSW	15	102305730	missense	probably benign	0.02
R4936:Espl1	UTSW	15	102304937	missense	probably damaging	1.00
R5000:Espl1	UTSW	15	102298551	missense	probably damaging	1.00
R5220:Espl1	UTSW	15	102298577	missense	probably benign	0.03
R5329:Espl1	UTSW	15	102312518	missense	probably damaging	0.97
R5501:Espl1	UTSW	15	102317130	missense	possibly damaging	0.51
R5788:Espl1	UTSW	15	102324030	missense	probably damaging	1.00
R5848:Espl1	UTSW	15	102322576	missense	probably benign	0.03
R5906:Espl1	UTSW	15	102296851	critical splice donor site	probably null
R5978:Espl1	UTSW	15	102315774	missense	possibly damaging	0.66
R6111:Espl1	UTSW	15	102299888	missense	probably damaging	0.99
R6313:Espl1	UTSW	15	102315812	missense	probably benign	0.00
R6414:Espl1	UTSW	15	102315560	missense	probably damaging	0.96
R6484:Espl1	UTSW	15	102323500	missense	possibly damaging	0.65
R6784:Espl1	UTSW	15	102299225	missense	probably benign
R6995:Espl1	UTSW	15	102304100	missense	possibly damaging	0.94
R7053:Espl1	UTSW	15	102316893	critical splice donor site	probably null
R7062:Espl1	UTSW	15	102298896	missense	probably benign	0.00
R7135:Espl1	UTSW	15	102319524	nonsense	probably null
R7154:Espl1	UTSW	15	102324049	missense	probably damaging	1.00
R7164:Espl1	UTSW	15	102313203	missense	probably damaging	1.00
R7522:Espl1	UTSW	15	102305051	missense	probably damaging	1.00
R7848:Espl1	UTSW	15	102316526	missense	probably damaging	1.00
R7894:Espl1	UTSW	15	102304025	missense	probably damaging	1.00
R8275:Espl1	UTSW	15	102302753	splice site	probably benign
R8752:Espl1	UTSW	15	102306324	missense	probably damaging	1.00
R9160:Espl1	UTSW	15	102298518	missense	probably damaging	1.00
R9310:Espl1	UTSW	15	102296850	critical splice donor site	probably null
R9385:Espl1	UTSW	15	102298750	missense	probably damaging	0.99
X0062:Espl1	UTSW	15	102298397	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CAAGGTCTAGATGAAGCTGATGC -3'
(R):5'- AGGAAGAACTGGCAGCTGTC -3'

Sequencing Primer
(F):5'- ATGAAGCTGATGCCGACTTC -3'
(R):5'- ACTGGCAGCTGTCGTACAATG -3'

Posted On

2018-11-06