Incidental Mutation 'R6929:Ifi203'
ID539883
Institutional Source Beutler Lab
Gene Symbol Ifi203
Ensembl Gene ENSMUSG00000039997
Gene Nameinterferon activated gene 203
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.097) question?
Stock #R6929 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location173920407-173942672 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) A to G at 173928774 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000114221 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042228] [ENSMUST00000081216] [ENSMUST00000111210] [ENSMUST00000123708] [ENSMUST00000129829] [ENSMUST00000156895]
Predicted Effect probably benign
Transcript: ENSMUST00000042228
SMART Domains Protein: ENSMUSP00000042071
Gene: ENSMUSG00000039997

DomainStartEndE-ValueType
PYRIN 6 84 1.01e-21 SMART
low complexity region 133 150 N/A INTRINSIC
low complexity region 170 188 N/A INTRINSIC
Pfam:HIN 251 418 1.5e-77 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000081216
SMART Domains Protein: ENSMUSP00000079976
Gene: ENSMUSG00000039997

DomainStartEndE-ValueType
PYRIN 6 84 1.01e-21 SMART
low complexity region 133 150 N/A INTRINSIC
low complexity region 174 183 N/A INTRINSIC
Pfam:HIN 203 370 1.3e-76 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111210
SMART Domains Protein: ENSMUSP00000106841
Gene: ENSMUSG00000090272

DomainStartEndE-ValueType
PYRIN 5 83 3.71e-20 SMART
internal_repeat_1 152 166 2.38e-7 PROSPERO
low complexity region 170 200 N/A INTRINSIC
internal_repeat_1 208 222 2.38e-7 PROSPERO
low complexity region 225 249 N/A INTRINSIC
low complexity region 276 292 N/A INTRINSIC
low complexity region 294 305 N/A INTRINSIC
Pfam:HIN 311 479 3.4e-76 PFAM
low complexity region 497 507 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000123708
SMART Domains Protein: ENSMUSP00000121480
Gene: ENSMUSG00000039997

DomainStartEndE-ValueType
PYRIN 6 84 1.01e-21 SMART
low complexity region 133 150 N/A INTRINSIC
low complexity region 174 183 N/A INTRINSIC
Pfam:HIN 203 370 1.3e-76 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000129829
AA Change: V481A
SMART Domains Protein: ENSMUSP00000122424
Gene: ENSMUSG00000039997
AA Change: V481A

DomainStartEndE-ValueType
PYRIN 6 84 1.01e-21 SMART
low complexity region 133 150 N/A INTRINSIC
low complexity region 170 188 N/A INTRINSIC
low complexity region 607 623 N/A INTRINSIC
Pfam:HIN 665 831 7.2e-73 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000156895
SMART Domains Protein: ENSMUSP00000114221
Gene: ENSMUSG00000039997

DomainStartEndE-ValueType
PYRIN 6 84 1.01e-21 SMART
low complexity region 133 150 N/A INTRINSIC
low complexity region 170 188 N/A INTRINSIC
Pfam:HIN 251 418 1.5e-77 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.4%
Validation Efficiency 92% (35/38)
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts13 A T 2: 27,006,263 R1223* probably null Het
Adgrb3 A T 1: 25,111,771 L1127* probably null Het
Ankrd17 A T 5: 90,285,525 V727D possibly damaging Het
Ankub1 A T 3: 57,665,433 C289* probably null Het
C2 T A 17: 34,864,347 I242F possibly damaging Het
C2cd3 T C 7: 100,451,619 L653P probably damaging Het
Cacna1b A G 2: 24,632,010 V1696A probably damaging Het
Cep295 A G 9: 15,333,062 I1366T probably damaging Het
Chd9 T C 8: 91,042,945 L2553P probably damaging Het
Cited4 C A 4: 120,667,047 T82K probably benign Het
Dnah6 A T 6: 73,044,773 M3470K probably damaging Het
Exosc3 G T 4: 45,320,482 P37Q probably damaging Het
Fam120b C A 17: 15,423,028 Q690K possibly damaging Het
Fyb T C 15: 6,638,907 I527T probably damaging Het
Gm32742 A G 9: 51,154,279 L459P probably benign Het
Gm45861 A G 8: 27,524,434 D655G unknown Het
Ifnar2 T A 16: 91,393,878 L93* probably null Het
Kdr A G 5: 75,978,104 V22A probably benign Het
Llgl1 C T 11: 60,710,353 Q706* probably null Het
Lrrc9 A T 12: 72,450,772 K121N probably benign Het
Lyst T C 13: 13,743,324 F3323S probably damaging Het
Mc4r A G 18: 66,859,182 Y287H probably damaging Het
Nlrp4e A C 7: 23,336,731 probably null Het
Olfr617 A T 7: 103,584,444 I141F probably damaging Het
Olfr901 A G 9: 38,431,148 I289V probably benign Het
Pear1 T A 3: 87,759,565 K38* probably null Het
Pik3c2g G A 6: 139,957,776 R585Q possibly damaging Het
Prpf40a A G 2: 53,144,863 V771A possibly damaging Het
Rnd3 G T 2: 51,137,175 D103E probably damaging Het
Sfpq GCCGCCGCAGCAGCCTCCGCCGCAGCAGCC GCCGCCGCAGCAGCC 4: 127,021,626 probably benign Het
Spats2l A T 1: 57,879,536 N43I probably damaging Het
Tmem202 C A 9: 59,519,221 G221C probably benign Het
Ubiad1 T C 4: 148,444,122 D110G probably damaging Het
Ulk4 A T 9: 121,074,015 V1132D probably benign Het
Vmn2r118 C T 17: 55,610,440 M357I probably benign Het
Zfp663 G C 2: 165,353,258 P347R probably benign Het
Other mutations in Ifi203
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00565:Ifi203 APN 1 173937740 critical splice donor site probably null
IGL02598:Ifi203 APN 1 173935002 splice site probably benign
IGL03172:Ifi203 APN 1 173936592 missense possibly damaging 0.94
IGL03334:Ifi203 APN 1 173937835 nonsense probably null
FR4304:Ifi203 UTSW 1 173928328 intron probably benign
R0593:Ifi203 UTSW 1 173928649 intron probably benign
R0827:Ifi203 UTSW 1 173928463 intron probably benign
R1163:Ifi203 UTSW 1 173924137 missense probably damaging 0.98
R1769:Ifi203 UTSW 1 173928760 nonsense probably null
R3415:Ifi203 UTSW 1 173928760 nonsense probably null
R3737:Ifi203 UTSW 1 173929474 intron probably benign
R3738:Ifi203 UTSW 1 173929474 intron probably benign
R3739:Ifi203 UTSW 1 173929474 intron probably benign
R3791:Ifi203 UTSW 1 173935080 missense possibly damaging 0.83
R3847:Ifi203 UTSW 1 173933796 missense possibly damaging 0.84
R4035:Ifi203 UTSW 1 173929474 intron probably benign
R4156:Ifi203 UTSW 1 173936540 missense probably damaging 0.98
R4164:Ifi203 UTSW 1 173928463 intron probably benign
R4171:Ifi203 UTSW 1 173933775 splice site probably benign
R4200:Ifi203 UTSW 1 173924115 missense probably damaging 0.99
R4233:Ifi203 UTSW 1 173936533 missense possibly damaging 0.92
R4845:Ifi203 UTSW 1 173927029 missense probably benign 0.00
R4880:Ifi203 UTSW 1 173929150 intron probably benign
R5071:Ifi203 UTSW 1 173935110 missense possibly damaging 0.92
R5108:Ifi203 UTSW 1 173924014 missense probably damaging 1.00
R5284:Ifi203 UTSW 1 173928708 intron probably benign
R5335:Ifi203 UTSW 1 173926919 missense possibly damaging 0.71
R6198:Ifi203 UTSW 1 173924082 missense probably damaging 0.97
R6236:Ifi203 UTSW 1 173933913 missense probably benign 0.33
R6397:Ifi203 UTSW 1 173927204 missense probably benign 0.33
R7025:Ifi203 UTSW 1 173928385 intron probably benign
R7149:Ifi203 UTSW 1 173928928 missense unknown
R7320:Ifi203 UTSW 1 173929167 missense unknown
R7631:Ifi203 UTSW 1 173927122 missense unknown
R7913:Ifi203 UTSW 1 173926957 missense probably damaging 1.00
R8183:Ifi203 UTSW 1 173928700 missense unknown
R8297:Ifi203 UTSW 1 173937930 missense probably damaging 1.00
Z1088:Ifi203 UTSW 1 173928581 intron probably benign
Predicted Primers PCR Primer
(F):5'- TGCCCCTTGTGTCAATGGAG -3'
(R):5'- TTCCTAAAGTTGCATCCTCCAG -3'

Sequencing Primer
(F):5'- GGTGCACTTATTTCTGGACAC -3'
(R):5'- GTTGCATCCTCCAGCAACAG -3'
Posted On2018-11-06