Incidental Mutation 'R6929:Adamts13'
ID539885
Institutional Source Beutler Lab
Gene Symbol Adamts13
Ensembl Gene ENSMUSG00000014852
Gene Namea disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 13
SynonymsvWF-CP mRNA for von Willebrand factor-cleaving, LOC279028
MMRRC Submission
Accession Numbers

NCBI RefSeq: NM_001001322.2; MGI:2685556

Is this an essential gene? Probably non essential (E-score: 0.104) question?
Stock #R6929 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location26973416-27009628 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 27006263 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 1223 (R1223*)
Ref Sequence ENSEMBL: ENSMUSP00000099955 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102891] [ENSMUST00000114003] [ENSMUST00000114004] [ENSMUST00000114005] [ENSMUST00000114006] [ENSMUST00000114007]
Predicted Effect probably null
Transcript: ENSMUST00000102891
AA Change: R1223*
SMART Domains Protein: ENSMUSP00000099955
Gene: ENSMUSG00000014852
AA Change: R1223*

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Pfam:Reprolysin_4 84 287 8.5e-11 PFAM
Pfam:Reprolysin 96 291 4.9e-14 PFAM
Pfam:Reprolysin_3 106 237 5.6e-11 PFAM
TSP1 392 444 3.29e-14 SMART
TSP1 693 748 7.01e0 SMART
TSP1 750 810 3.34e-6 SMART
TSP1 904 959 5.85e0 SMART
TSP1 961 1019 2.69e0 SMART
Blast:TSP1 1022 1079 4e-26 BLAST
TSP1 1081 1137 4.58e-4 SMART
Blast:CUB 1196 1293 2e-39 BLAST
Blast:CUB 1303 1412 3e-63 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000114003
SMART Domains Protein: ENSMUSP00000109636
Gene: ENSMUSG00000015488

DomainStartEndE-ValueType
Cg6151-P 1 80 6.19e-34 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114004
SMART Domains Protein: ENSMUSP00000109637
Gene: ENSMUSG00000015488

DomainStartEndE-ValueType
low complexity region 5 17 N/A INTRINSIC
Cg6151-P 33 106 7.88e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114005
SMART Domains Protein: ENSMUSP00000109638
Gene: ENSMUSG00000015488

DomainStartEndE-ValueType
low complexity region 5 17 N/A INTRINSIC
Cg6151-P 33 114 5.53e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114006
SMART Domains Protein: ENSMUSP00000109639
Gene: ENSMUSG00000015488

DomainStartEndE-ValueType
low complexity region 5 17 N/A INTRINSIC
Cg6151-P 33 142 2.87e-61 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114007
SMART Domains Protein: ENSMUSP00000109640
Gene: ENSMUSG00000015488

DomainStartEndE-ValueType
low complexity region 5 17 N/A INTRINSIC
Cg6151-P 33 142 2.87e-61 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000133807
SMART Domains Protein: ENSMUSP00000122562
Gene: ENSMUSG00000015488

DomainStartEndE-ValueType
low complexity region 29 42 N/A INTRINSIC
Cg6151-P 53 118 8.02e-10 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.4%
Validation Efficiency 92% (35/38)
MGI Phenotype FUNCTION: This gene encodes a member of "a disintegrin and metalloproteinase with thrombospondin motifs" (ADAMTS) family of multi-domain matrix-associated metalloendopeptidases that have diverse roles in tissue morphogenesis and pathophysiological remodeling, in inflammation and in vascular biology. In certain mouse strains (C57BL/6, for example) an intracisternal A-type particle (IAP) retrotransposon sequence is located in the intron 23 that causes an alternate splicing event resulting in a shorter transcript variants encoding shorter isoforms. The encoded preproprotein undergoes proteolytic processing to generate an active enzyme that cleaves von Willebrand factor (VWF) in circulating blood. [provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygous mutation of this gene results in thrombocytopenia, decreased survival, and increased susceptibility to developing thrombotic thrombocytopenic purpura after shiga toxin injection. On a different background, mutants are viable and fertile. [provided by MGI curators]
Allele List at MGI

All alleles(10) : Targeted(7) Gene trapped(2) Spontaneous(1)

Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb3 A T 1: 25,111,771 L1127* probably null Het
Ankrd17 A T 5: 90,285,525 V727D possibly damaging Het
Ankub1 A T 3: 57,665,433 C289* probably null Het
C2 T A 17: 34,864,347 I242F possibly damaging Het
C2cd3 T C 7: 100,451,619 L653P probably damaging Het
Cacna1b A G 2: 24,632,010 V1696A probably damaging Het
Cep295 A G 9: 15,333,062 I1366T probably damaging Het
Chd9 T C 8: 91,042,945 L2553P probably damaging Het
Cited4 C A 4: 120,667,047 T82K probably benign Het
Dnah6 A T 6: 73,044,773 M3470K probably damaging Het
Exosc3 G T 4: 45,320,482 P37Q probably damaging Het
Fam120b C A 17: 15,423,028 Q690K possibly damaging Het
Fyb T C 15: 6,638,907 I527T probably damaging Het
Gm32742 A G 9: 51,154,279 L459P probably benign Het
Gm45861 A G 8: 27,524,434 D655G unknown Het
Ifi203 A G 1: 173,928,774 probably benign Het
Ifnar2 T A 16: 91,393,878 L93* probably null Het
Kdr A G 5: 75,978,104 V22A probably benign Het
Llgl1 C T 11: 60,710,353 Q706* probably null Het
Lrrc9 A T 12: 72,450,772 K121N probably benign Het
Lyst T C 13: 13,743,324 F3323S probably damaging Het
Mc4r A G 18: 66,859,182 Y287H probably damaging Het
Nlrp4e A C 7: 23,336,731 probably null Het
Olfr617 A T 7: 103,584,444 I141F probably damaging Het
Olfr901 A G 9: 38,431,148 I289V probably benign Het
Pear1 T A 3: 87,759,565 K38* probably null Het
Pik3c2g G A 6: 139,957,776 R585Q possibly damaging Het
Prpf40a A G 2: 53,144,863 V771A possibly damaging Het
Rnd3 G T 2: 51,137,175 D103E probably damaging Het
Sfpq GCCGCCGCAGCAGCCTCCGCCGCAGCAGCC GCCGCCGCAGCAGCC 4: 127,021,626 probably benign Het
Spats2l A T 1: 57,879,536 N43I probably damaging Het
Tmem202 C A 9: 59,519,221 G221C probably benign Het
Ubiad1 T C 4: 148,444,122 D110G probably damaging Het
Ulk4 A T 9: 121,074,015 V1132D probably benign Het
Vmn2r118 C T 17: 55,610,440 M357I probably benign Het
Zfp663 G C 2: 165,353,258 P347R probably benign Het
Other mutations in Adamts13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Adamts13 APN 2 27005361 missense probably benign 0.04
IGL00465:Adamts13 APN 2 26973555 missense probably benign 0.32
IGL01114:Adamts13 APN 2 27005190 missense probably benign 0.41
IGL01138:Adamts13 APN 2 26983042 missense probably damaging 1.00
IGL01154:Adamts13 APN 2 27006194 missense probably benign
IGL01860:Adamts13 APN 2 26978011 missense probably damaging 0.99
IGL01924:Adamts13 APN 2 26996583 missense possibly damaging 0.80
IGL01991:Adamts13 APN 2 26990598 missense probably damaging 0.97
IGL02215:Adamts13 APN 2 26985483 missense probably damaging 1.00
IGL02415:Adamts13 APN 2 26989283 missense possibly damaging 0.95
IGL02519:Adamts13 APN 2 26978675 missense probably damaging 1.00
IGL02956:Adamts13 APN 2 26983037 missense probably benign 0.18
IGL03209:Adamts13 APN 2 26992961 missense probably benign 0.00
I1329:Adamts13 UTSW 2 26973619 missense possibly damaging 0.52
IGL02837:Adamts13 UTSW 2 26991420 missense probably benign 0.01
IGL03048:Adamts13 UTSW 2 26978699 critical splice donor site probably null
R0041:Adamts13 UTSW 2 26983974 missense probably damaging 1.00
R0217:Adamts13 UTSW 2 26996921 splice site probably benign
R0276:Adamts13 UTSW 2 26975760 missense possibly damaging 0.91
R0309:Adamts13 UTSW 2 26986989 missense probably damaging 0.99
R0348:Adamts13 UTSW 2 26981080 missense probably benign 0.13
R0369:Adamts13 UTSW 2 27005186 missense probably benign 0.00
R0386:Adamts13 UTSW 2 26986679 splice site probably null
R0553:Adamts13 UTSW 2 26991334 nonsense probably null
R0714:Adamts13 UTSW 2 26986985 splice site probably benign
R0862:Adamts13 UTSW 2 27006324 critical splice donor site probably null
R1320:Adamts13 UTSW 2 26989246 missense probably damaging 0.97
R1458:Adamts13 UTSW 2 26988354 missense probably damaging 1.00
R1473:Adamts13 UTSW 2 26981753 nonsense probably null
R1491:Adamts13 UTSW 2 26978315 missense probably damaging 1.00
R1588:Adamts13 UTSW 2 26975675 missense probably benign 0.01
R1638:Adamts13 UTSW 2 26996583 missense possibly damaging 0.80
R1724:Adamts13 UTSW 2 26991294 missense probably benign 0.00
R1924:Adamts13 UTSW 2 26984141 missense probably damaging 1.00
R2001:Adamts13 UTSW 2 26973990 missense probably benign
R2072:Adamts13 UTSW 2 27005425 missense probably benign 0.10
R2073:Adamts13 UTSW 2 27006314 missense probably damaging 1.00
R2409:Adamts13 UTSW 2 26978362 missense probably benign 0.00
R4362:Adamts13 UTSW 2 27004782 missense probably damaging 1.00
R4363:Adamts13 UTSW 2 27004782 missense probably damaging 1.00
R4422:Adamts13 UTSW 2 27005400 missense probably benign 0.00
R4769:Adamts13 UTSW 2 27008711 nonsense probably null
R4785:Adamts13 UTSW 2 26983042 missense probably damaging 1.00
R4831:Adamts13 UTSW 2 26983130 critical splice donor site probably null
R4832:Adamts13 UTSW 2 26989402 missense probably benign 0.22
R4945:Adamts13 UTSW 2 26986610 missense probably damaging 1.00
R5047:Adamts13 UTSW 2 26996910 missense probably damaging 0.98
R5126:Adamts13 UTSW 2 26996915 critical splice donor site probably null
R5161:Adamts13 UTSW 2 26993008 missense probably benign 0.00
R5394:Adamts13 UTSW 2 26986558 missense probably benign 0.00
R5557:Adamts13 UTSW 2 26973639 missense probably benign 0.05
R5660:Adamts13 UTSW 2 26996749 missense probably benign
R5890:Adamts13 UTSW 2 26986591 missense probably damaging 0.96
R6168:Adamts13 UTSW 2 27004886 missense probably benign 0.37
R6536:Adamts13 UTSW 2 26975750 missense probably damaging 0.99
R7207:Adamts13 UTSW 2 26978695 missense probably damaging 1.00
R7211:Adamts13 UTSW 2 26989298 missense probably benign 0.40
R7212:Adamts13 UTSW 2 27006314 missense probably damaging 1.00
R7392:Adamts13 UTSW 2 26989324 missense probably damaging 1.00
R7583:Adamts13 UTSW 2 26973953 missense probably benign
R7604:Adamts13 UTSW 2 27005206 missense probably benign 0.00
R7783:Adamts13 UTSW 2 26990585 missense not run
R7814:Adamts13 UTSW 2 26996549 missense probably benign
R8076:Adamts13 UTSW 2 26990612 missense probably benign 0.06
R8245:Adamts13 UTSW 2 26990556 missense probably damaging 1.00
X0027:Adamts13 UTSW 2 26985546 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CACAGAAGTGGCCTAGTGTC -3'
(R):5'- ATCGCCACACTCCAGTCATG -3'

Sequencing Primer
(F):5'- CTGGTGACTATTGCTGTGACATAC -3'
(R):5'- CACACTCCAGTCATGAGAAGTAGG -3'
Posted On2018-11-06