Mutagenetix > Incidental Mutations

Incidental Mutation 'R6929:Adamts13'

539885

Institutional Source

Beutler Lab

Gene Symbol

Adamts13

Ensembl Gene

ENSMUSG00000014852

Gene Name

a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 13

Synonyms

vWF-CP mRNA for von Willebrand factor-cleaving, LOC279028

MMRRC Submission

Accession Numbers

NCBI RefSeq: NM_001001322.2; MGI:2685556

Is this an essential gene?

Probably non essential (E-score: 0.104) question?

Stock #

R6929 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

26973416-27009628 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

A to T at 27006263 bp

Zygosity

Heterozygous

Amino Acid Change

Arginine to Stop codon at position 1223 (R1223*)

Ref Sequence

ENSEMBL: ENSMUSP00000099955 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000102891] [ENSMUST00000114003] [ENSMUST00000114004] [ENSMUST00000114005] [ENSMUST00000114006] [ENSMUST00000114007]

Predicted Effect

probably null
Transcript: ENSMUST00000102891
AA Change: R1223*

SMART Domains

Protein: ENSMUSP00000099955
Gene: ENSMUSG00000014852
AA Change: R1223*

Domain	Start	End	E-Value	Type
transmembrane domain	13	35	N/A	INTRINSIC
Pfam:Reprolysin_4	84	287	8.5e-11	PFAM
Pfam:Reprolysin	96	291	4.9e-14	PFAM
Pfam:Reprolysin_3	106	237	5.6e-11	PFAM
TSP1	392	444	3.29e-14	SMART
TSP1	693	748	7.01e0	SMART
TSP1	750	810	3.34e-6	SMART
TSP1	904	959	5.85e0	SMART
TSP1	961	1019	2.69e0	SMART
Blast:TSP1	1022	1079	4e-26	BLAST
TSP1	1081	1137	4.58e-4	SMART
Blast:CUB	1196	1293	2e-39	BLAST
Blast:CUB	1303	1412	3e-63	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000114003

SMART Domains

Protein: ENSMUSP00000109636
Gene: ENSMUSG00000015488

Domain	Start	End	E-Value	Type
Cg6151-P	1	80	6.19e-34	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000114004

SMART Domains

Protein: ENSMUSP00000109637
Gene: ENSMUSG00000015488

Domain	Start	End	E-Value	Type
low complexity region	5	17	N/A	INTRINSIC
Cg6151-P	33	106	7.88e-18	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000114005

SMART Domains

Protein: ENSMUSP00000109638
Gene: ENSMUSG00000015488

Domain	Start	End	E-Value	Type
low complexity region	5	17	N/A	INTRINSIC
Cg6151-P	33	114	5.53e-22	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000114006

SMART Domains

Protein: ENSMUSP00000109639
Gene: ENSMUSG00000015488

Domain	Start	End	E-Value	Type
low complexity region	5	17	N/A	INTRINSIC
Cg6151-P	33	142	2.87e-61	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000114007

SMART Domains

Protein: ENSMUSP00000109640
Gene: ENSMUSG00000015488

Domain	Start	End	E-Value	Type
low complexity region	5	17	N/A	INTRINSIC
Cg6151-P	33	142	2.87e-61	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000133807

SMART Domains

Protein: ENSMUSP00000122562
Gene: ENSMUSG00000015488

Domain	Start	End	E-Value	Type
low complexity region	29	42	N/A	INTRINSIC
Cg6151-P	53	118	8.02e-10	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.2%
20x: 97.4%

Validation Efficiency

92% (35/38)

MGI Phenotype

FUNCTION: This gene encodes a member of "a disintegrin and metalloproteinase with thrombospondin motifs" (ADAMTS) family of multi-domain matrix-associated metalloendopeptidases that have diverse roles in tissue morphogenesis and pathophysiological remodeling, in inflammation and in vascular biology. In certain mouse strains (C57BL/6, for example) an intracisternal A-type particle (IAP) retrotransposon sequence is located in the intron 23 that causes an alternate splicing event resulting in a shorter transcript variants encoding shorter isoforms. The encoded preproprotein undergoes proteolytic processing to generate an active enzyme that cleaves von Willebrand factor (VWF) in circulating blood. [provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygous mutation of this gene results in thrombocytopenia, decreased survival, and increased susceptibility to developing thrombotic thrombocytopenic purpura after shiga toxin injection. On a different background, mutants are viable and fertile. [provided by MGI curators]

Allele List at MGI

All alleles(10) : Targeted(7) Gene trapped(2) Spontaneous(1)

Other mutations in this stock

Total: 36 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgrb3	A	T	1: 25,111,771	L1127*	probably null	Het
Ankrd17	A	T	5: 90,285,525	V727D	possibly damaging	Het
Ankub1	A	T	3: 57,665,433	C289*	probably null	Het
C2	T	A	17: 34,864,347	I242F	possibly damaging	Het
C2cd3	T	C	7: 100,451,619	L653P	probably damaging	Het
Cacna1b	A	G	2: 24,632,010	V1696A	probably damaging	Het
Cep295	A	G	9: 15,333,062	I1366T	probably damaging	Het
Chd9	T	C	8: 91,042,945	L2553P	probably damaging	Het
Cited4	C	A	4: 120,667,047	T82K	probably benign	Het
Dnah6	A	T	6: 73,044,773	M3470K	probably damaging	Het
Exosc3	G	T	4: 45,320,482	P37Q	probably damaging	Het
Fam120b	C	A	17: 15,423,028	Q690K	possibly damaging	Het
Fyb	T	C	15: 6,638,907	I527T	probably damaging	Het
Gm32742	A	G	9: 51,154,279	L459P	probably benign	Het
Gm45861	A	G	8: 27,524,434	D655G	unknown	Het
Ifi203	A	G	1: 173,928,774		probably benign	Het
Ifnar2	T	A	16: 91,393,878	L93*	probably null	Het
Kdr	A	G	5: 75,978,104	V22A	probably benign	Het
Llgl1	C	T	11: 60,710,353	Q706*	probably null	Het
Lrrc9	A	T	12: 72,450,772	K121N	probably benign	Het
Lyst	T	C	13: 13,743,324	F3323S	probably damaging	Het
Mc4r	A	G	18: 66,859,182	Y287H	probably damaging	Het
Nlrp4e	A	C	7: 23,336,731		probably null	Het
Olfr617	A	T	7: 103,584,444	I141F	probably damaging	Het
Olfr901	A	G	9: 38,431,148	I289V	probably benign	Het
Pear1	T	A	3: 87,759,565	K38*	probably null	Het
Pik3c2g	G	A	6: 139,957,776	R585Q	possibly damaging	Het
Prpf40a	A	G	2: 53,144,863	V771A	possibly damaging	Het
Rnd3	G	T	2: 51,137,175	D103E	probably damaging	Het
Sfpq	GCCGCCGCAGCAGCCTCCGCCGCAGCAGCC	GCCGCCGCAGCAGCC	4: 127,021,626		probably benign	Het
Spats2l	A	T	1: 57,879,536	N43I	probably damaging	Het
Tmem202	C	A	9: 59,519,221	G221C	probably benign	Het
Ubiad1	T	C	4: 148,444,122	D110G	probably damaging	Het
Ulk4	A	T	9: 121,074,015	V1132D	probably benign	Het
Vmn2r118	C	T	17: 55,610,440	M357I	probably benign	Het
Zfp663	G	C	2: 165,353,258	P347R	probably benign	Het

Other mutations in Adamts13

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00089:Adamts13	APN	2	27005361	missense	probably benign	0.04
IGL00465:Adamts13	APN	2	26973555	missense	probably benign	0.32
IGL01114:Adamts13	APN	2	27005190	missense	probably benign	0.41
IGL01138:Adamts13	APN	2	26983042	missense	probably damaging	1.00
IGL01154:Adamts13	APN	2	27006194	missense	probably benign
IGL01860:Adamts13	APN	2	26978011	missense	probably damaging	0.99
IGL01924:Adamts13	APN	2	26996583	missense	possibly damaging	0.80
IGL01991:Adamts13	APN	2	26990598	missense	probably damaging	0.97
IGL02215:Adamts13	APN	2	26985483	missense	probably damaging	1.00
IGL02415:Adamts13	APN	2	26989283	missense	possibly damaging	0.95
IGL02519:Adamts13	APN	2	26978675	missense	probably damaging	1.00
IGL02956:Adamts13	APN	2	26983037	missense	probably benign	0.18
IGL03209:Adamts13	APN	2	26992961	missense	probably benign	0.00
I1329:Adamts13	UTSW	2	26973619	missense	possibly damaging	0.52
IGL02837:Adamts13	UTSW	2	26991420	missense	probably benign	0.01
IGL03048:Adamts13	UTSW	2	26978699	critical splice donor site	probably null
R0041:Adamts13	UTSW	2	26983974	missense	probably damaging	1.00
R0217:Adamts13	UTSW	2	26996921	splice site	probably benign
R0276:Adamts13	UTSW	2	26975760	missense	possibly damaging	0.91
R0309:Adamts13	UTSW	2	26986989	missense	probably damaging	0.99
R0348:Adamts13	UTSW	2	26981080	missense	probably benign	0.13
R0369:Adamts13	UTSW	2	27005186	missense	probably benign	0.00
R0386:Adamts13	UTSW	2	26986679	splice site	probably null
R0553:Adamts13	UTSW	2	26991334	nonsense	probably null
R0714:Adamts13	UTSW	2	26986985	splice site	probably benign
R0862:Adamts13	UTSW	2	27006324	critical splice donor site	probably null
R1320:Adamts13	UTSW	2	26989246	missense	probably damaging	0.97
R1458:Adamts13	UTSW	2	26988354	missense	probably damaging	1.00
R1473:Adamts13	UTSW	2	26981753	nonsense	probably null
R1491:Adamts13	UTSW	2	26978315	missense	probably damaging	1.00
R1588:Adamts13	UTSW	2	26975675	missense	probably benign	0.01
R1638:Adamts13	UTSW	2	26996583	missense	possibly damaging	0.80
R1724:Adamts13	UTSW	2	26991294	missense	probably benign	0.00
R1924:Adamts13	UTSW	2	26984141	missense	probably damaging	1.00
R2001:Adamts13	UTSW	2	26973990	missense	probably benign
R2072:Adamts13	UTSW	2	27005425	missense	probably benign	0.10
R2073:Adamts13	UTSW	2	27006314	missense	probably damaging	1.00
R2409:Adamts13	UTSW	2	26978362	missense	probably benign	0.00
R4362:Adamts13	UTSW	2	27004782	missense	probably damaging	1.00
R4363:Adamts13	UTSW	2	27004782	missense	probably damaging	1.00
R4422:Adamts13	UTSW	2	27005400	missense	probably benign	0.00
R4769:Adamts13	UTSW	2	27008711	nonsense	probably null
R4785:Adamts13	UTSW	2	26983042	missense	probably damaging	1.00
R4831:Adamts13	UTSW	2	26983130	critical splice donor site	probably null
R4832:Adamts13	UTSW	2	26989402	missense	probably benign	0.22
R4945:Adamts13	UTSW	2	26986610	missense	probably damaging	1.00
R5047:Adamts13	UTSW	2	26996910	missense	probably damaging	0.98
R5126:Adamts13	UTSW	2	26996915	critical splice donor site	probably null
R5161:Adamts13	UTSW	2	26993008	missense	probably benign	0.00
R5394:Adamts13	UTSW	2	26986558	missense	probably benign	0.00
R5557:Adamts13	UTSW	2	26973639	missense	probably benign	0.05
R5660:Adamts13	UTSW	2	26996749	missense	probably benign
R5890:Adamts13	UTSW	2	26986591	missense	probably damaging	0.96
R6168:Adamts13	UTSW	2	27004886	missense	probably benign	0.37
R6536:Adamts13	UTSW	2	26975750	missense	probably damaging	0.99
R7207:Adamts13	UTSW	2	26978695	missense	probably damaging	1.00
R7211:Adamts13	UTSW	2	26989298	missense	probably benign	0.40
R7212:Adamts13	UTSW	2	27006314	missense	probably damaging	1.00
R7392:Adamts13	UTSW	2	26989324	missense	probably damaging	1.00
R7583:Adamts13	UTSW	2	26973953	missense	probably benign
R7604:Adamts13	UTSW	2	27005206	missense	probably benign	0.00
R7783:Adamts13	UTSW	2	26990585	missense	not run
R7814:Adamts13	UTSW	2	26996549	missense	probably benign
R8076:Adamts13	UTSW	2	26990612	missense	probably benign	0.06
R8245:Adamts13	UTSW	2	26990556	missense	probably damaging	1.00
X0027:Adamts13	UTSW	2	26985546	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- CACAGAAGTGGCCTAGTGTC -3'
(R):5'- ATCGCCACACTCCAGTCATG -3'

Sequencing Primer
(F):5'- CTGGTGACTATTGCTGTGACATAC -3'
(R):5'- CACACTCCAGTCATGAGAAGTAGG -3'

Posted On

2018-11-06